Incidental Mutation 'R5365:Zdhhc12'
ID423065
Institutional Source Beutler Lab
Gene Symbol Zdhhc12
Ensembl Gene ENSMUSG00000015335
Gene Namezinc finger, DHHC domain containing 12
Synonyms1190004A01Rik
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30090944-30093648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30093509 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 27 (V27A)
Ref Sequence ENSEMBL: ENSMUSP00000099929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000045246] [ENSMUST00000081838] [ENSMUST00000102865] [ENSMUST00000113677]
Predicted Effect probably benign
Transcript: ENSMUST00000044751
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000045246
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081838
AA Change: V27A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080521
Gene: ENSMUSG00000015335
AA Change: V27A

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:zf-DHHC 106 232 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102865
AA Change: V27A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099929
Gene: ENSMUSG00000015335
AA Change: V27A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:zf-DHHC 58 218 1.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113677
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148717
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Other mutations in Zdhhc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Zdhhc12 APN 2 30091436 missense probably damaging 1.00
IGL02635:Zdhhc12 APN 2 30093519 missense probably damaging 1.00
R0066:Zdhhc12 UTSW 2 30092535 missense probably damaging 1.00
R0066:Zdhhc12 UTSW 2 30092535 missense probably damaging 1.00
R2106:Zdhhc12 UTSW 2 30091802 missense probably damaging 1.00
R4583:Zdhhc12 UTSW 2 30091484 missense probably benign
R4974:Zdhhc12 UTSW 2 30091526 missense probably damaging 1.00
R5561:Zdhhc12 UTSW 2 30092484 missense probably null 1.00
R7837:Zdhhc12 UTSW 2 30091697 missense probably damaging 0.96
R7920:Zdhhc12 UTSW 2 30091697 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCAACTTGGGAATCAGGC -3'
(R):5'- CAATAGACAGCCTCCCTGAG -3'

Sequencing Primer
(F):5'- CGGAGAGAGGATGATCCCC -3'
(R):5'- TGCCCCGCCTCTAATGCAG -3'
Posted On2016-08-04