Incidental Mutation 'R5365:Bnc2'
ID423074
Institutional Source Beutler Lab
Gene Symbol Bnc2
Ensembl Gene ENSMUSG00000028487
Gene Namebasonuclin 2
Synonyms
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location84275095-84675275 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 84411429 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102820] [ENSMUST00000107198] [ENSMUST00000175756] [ENSMUST00000175800] [ENSMUST00000175969] [ENSMUST00000176346] [ENSMUST00000176418] [ENSMUST00000176612] [ENSMUST00000176691] [ENSMUST00000176947]
Predicted Effect probably benign
Transcript: ENSMUST00000102820
SMART Domains Protein: ENSMUSP00000099884
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 362 378 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 469 492 4.72e-2 SMART
ZnF_C2H2 497 526 7.11e0 SMART
low complexity region 612 629 N/A INTRINSIC
low complexity region 633 642 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
ZnF_C2H2 861 884 1.62e0 SMART
ZnF_C2H2 889 916 4.81e0 SMART
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1048 1062 N/A INTRINSIC
ZnF_C2H2 1063 1086 1.03e-2 SMART
ZnF_C2H2 1091 1118 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107198
SMART Domains Protein: ENSMUSP00000102816
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 334 350 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
ZnF_C2H2 441 464 4.72e-2 SMART
ZnF_C2H2 469 498 7.11e0 SMART
low complexity region 584 601 N/A INTRINSIC
low complexity region 605 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
ZnF_C2H2 833 856 1.62e0 SMART
ZnF_C2H2 861 888 4.81e0 SMART
low complexity region 963 980 N/A INTRINSIC
low complexity region 1020 1034 N/A INTRINSIC
ZnF_C2H2 1035 1058 1.03e-2 SMART
ZnF_C2H2 1063 1090 3.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123276
Predicted Effect probably benign
Transcript: ENSMUST00000175756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175757
Predicted Effect probably benign
Transcript: ENSMUST00000175800
SMART Domains Protein: ENSMUSP00000134795
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 256 272 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176264
Predicted Effect probably benign
Transcript: ENSMUST00000176346
SMART Domains Protein: ENSMUSP00000134942
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176418
SMART Domains Protein: ENSMUSP00000135569
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 367 383 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176476
Predicted Effect probably benign
Transcript: ENSMUST00000176612
SMART Domains Protein: ENSMUSP00000135778
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 292 308 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
ZnF_C2H2 399 422 4.72e-2 SMART
ZnF_C2H2 427 456 7.11e0 SMART
low complexity region 542 559 N/A INTRINSIC
low complexity region 563 572 N/A INTRINSIC
low complexity region 606 620 N/A INTRINSIC
ZnF_C2H2 791 814 1.62e0 SMART
low complexity region 832 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176691
SMART Domains Protein: ENSMUSP00000135375
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 374 397 4.72e-2 SMART
ZnF_C2H2 402 431 7.11e0 SMART
low complexity region 517 534 N/A INTRINSIC
low complexity region 538 547 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
ZnF_C2H2 766 789 1.62e0 SMART
ZnF_C2H2 794 821 4.81e0 SMART
low complexity region 896 913 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
ZnF_C2H2 968 991 1.03e-2 SMART
ZnF_C2H2 996 1023 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176947
Predicted Effect unknown
Transcript: ENSMUST00000177040
AA Change: T117A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177256
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved zinc finger protein. The encoded protein functions in skin color saturation. Mutations in this gene are associated with facial pigmented spots. This gene is also associated with susceptibility to adolescent idiopathic scoliosis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap insertion die within 24 hrs of birth and display cleft palate, an overall size reduction of the head and tongue, and abnormal craniofacial bone development due to impaired multiplication of embryonic craniofacial mesenchymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Bnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Bnc2 APN 4 84276241 unclassified probably null
IGL01902:Bnc2 APN 4 84390944 missense probably damaging 1.00
IGL02228:Bnc2 APN 4 84293076 missense possibly damaging 0.70
IGL02396:Bnc2 APN 4 84276009 missense probably benign 0.16
R0125:Bnc2 UTSW 4 84292932 missense probably damaging 1.00
R0650:Bnc2 UTSW 4 84293196 missense probably benign 0.04
R1082:Bnc2 UTSW 4 84546335 missense probably damaging 1.00
R1334:Bnc2 UTSW 4 84276289 missense possibly damaging 0.49
R1439:Bnc2 UTSW 4 84276068 missense probably benign 0.38
R1447:Bnc2 UTSW 4 84293220 missense probably benign 0.13
R1515:Bnc2 UTSW 4 84414326 missense probably null 0.99
R1548:Bnc2 UTSW 4 84275957 missense probably damaging 1.00
R1818:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R1819:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R2345:Bnc2 UTSW 4 84292503 missense probably damaging 1.00
R2897:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2898:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2966:Bnc2 UTSW 4 84293517 missense probably benign 0.14
R3404:Bnc2 UTSW 4 84546241 missense probably damaging 0.98
R4235:Bnc2 UTSW 4 84293514 missense probably damaging 0.96
R4546:Bnc2 UTSW 4 84291976 missense probably benign 0.34
R4676:Bnc2 UTSW 4 84292819 missense probably damaging 1.00
R4926:Bnc2 UTSW 4 84276179 missense probably damaging 1.00
R5060:Bnc2 UTSW 4 84531635 missense probably benign 0.02
R5735:Bnc2 UTSW 4 84292671 missense probably damaging 1.00
R5872:Bnc2 UTSW 4 84292770 missense possibly damaging 0.86
R5921:Bnc2 UTSW 4 84293055 missense possibly damaging 0.95
R5999:Bnc2 UTSW 4 84555900 missense probably benign 0.20
R6351:Bnc2 UTSW 4 84293143 missense probably benign 0.16
R6869:Bnc2 UTSW 4 84293496 missense probably damaging 1.00
R7236:Bnc2 UTSW 4 84555864 missense probably benign 0.31
R7363:Bnc2 UTSW 4 84292071 missense probably benign 0.02
R7643:Bnc2 UTSW 4 84506574 missense probably benign 0.01
X0021:Bnc2 UTSW 4 84293140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTACATACAGAGACATGCAC -3'
(R):5'- GAGCACCCACTCATTTTGCC -3'

Sequencing Primer
(F):5'- GTACATACAGAGACATGCACATATG -3'
(R):5'- GCCCCTAGCATTTCCACTAATTG -3'
Posted On2016-08-04