Incidental Mutation 'R5365:Otof'
ID 423076
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Name otoferlin
Synonyms
MMRRC Submission 042943-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5365 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 30524406-30619276 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30539144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1090 (Y1090C)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074171
AA Change: Y1075C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: Y1075C

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114747
AA Change: Y1090C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: Y1090C

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133509
AA Change: Y1090C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372
AA Change: Y1090C

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.4e-2 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,578,629 (GRCm39) E4877G probably damaging Het
Acss3 C T 10: 106,840,589 (GRCm39) A391T probably damaging Het
Bcan T C 3: 87,896,542 (GRCm39) Y718C probably damaging Het
Bnc2 T C 4: 84,329,666 (GRCm39) probably benign Het
Bpnt2 G A 4: 4,776,385 (GRCm39) T190I probably damaging Het
Card6 A G 15: 5,134,888 (GRCm39) V105A possibly damaging Het
Ceacam5 A G 7: 17,493,473 (GRCm39) Y832C probably damaging Het
Ces2e T C 8: 105,653,846 (GRCm39) probably null Het
Cpt1b A T 15: 89,304,310 (GRCm39) I480N possibly damaging Het
Csmd3 T C 15: 47,868,145 (GRCm39) T792A possibly damaging Het
Ctsq T A 13: 61,185,632 (GRCm39) I170F possibly damaging Het
Cyfip2 A G 11: 46,138,457 (GRCm39) S772P probably damaging Het
Cyp3a16 A C 5: 145,389,597 (GRCm39) M256R probably damaging Het
Dgkd C T 1: 87,863,138 (GRCm39) R62C probably damaging Het
Ephx3 A G 17: 32,408,223 (GRCm39) L67P probably damaging Het
Gpc2 A G 5: 138,273,885 (GRCm39) Y438H probably damaging Het
Hnrnpul2 T A 19: 8,798,080 (GRCm39) H145Q probably benign Het
Igkv9-120 T C 6: 68,027,433 (GRCm39) S116P probably benign Het
Itgal A G 7: 126,904,522 (GRCm39) I332V probably damaging Het
Lrit1 A G 14: 36,784,099 (GRCm39) T476A probably benign Het
Lrp1b T C 2: 40,537,137 (GRCm39) H50R possibly damaging Het
Marchf7 T C 2: 60,064,258 (GRCm39) V178A possibly damaging Het
Mbtps2 G A X: 156,351,295 (GRCm39) T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 (GRCm39) P2542L probably damaging Het
Mill2 T C 7: 18,592,339 (GRCm39) V320A probably benign Het
Mtor G A 4: 148,634,587 (GRCm39) V2403M probably damaging Het
Nectin3 T A 16: 46,284,469 (GRCm39) K71* probably null Het
Or2g25 T A 17: 37,970,586 (GRCm39) I213F probably damaging Het
Pigf A T 17: 87,331,136 (GRCm39) V62E possibly damaging Het
Pla1a A G 16: 38,237,569 (GRCm39) L43P probably benign Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,519,929 (GRCm39) probably null Het
Tgm4 A C 9: 122,895,866 (GRCm39) K223N probably damaging Het
Ttn G T 2: 76,744,990 (GRCm39) A5353E probably damaging Het
Ywhaq T C 12: 21,446,389 (GRCm39) E159G possibly damaging Het
Zdhhc12 A G 2: 29,983,521 (GRCm39) V27A probably damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30,533,248 (GRCm39) missense probably damaging 1.00
IGL00391:Otof APN 5 30,532,967 (GRCm39) missense probably damaging 1.00
IGL00579:Otof APN 5 30,556,666 (GRCm39) missense possibly damaging 0.88
IGL00671:Otof APN 5 30,543,097 (GRCm39) critical splice donor site probably null
IGL01019:Otof APN 5 30,562,560 (GRCm39) missense probably benign 0.01
IGL01025:Otof APN 5 30,541,597 (GRCm39) missense possibly damaging 0.82
IGL01086:Otof APN 5 30,533,617 (GRCm39) critical splice donor site probably null
IGL01110:Otof APN 5 30,619,069 (GRCm39) missense probably damaging 1.00
IGL01160:Otof APN 5 30,538,879 (GRCm39) missense probably benign 0.00
IGL01285:Otof APN 5 30,562,527 (GRCm39) missense probably damaging 1.00
IGL01329:Otof APN 5 30,598,723 (GRCm39) missense probably benign 0.00
IGL01337:Otof APN 5 30,576,856 (GRCm39) missense probably benign 0.17
IGL01337:Otof APN 5 30,563,121 (GRCm39) missense possibly damaging 0.93
IGL01834:Otof APN 5 30,556,564 (GRCm39) missense probably damaging 1.00
IGL01872:Otof APN 5 30,536,598 (GRCm39) splice site probably benign
IGL01969:Otof APN 5 30,539,827 (GRCm39) splice site probably benign
IGL02075:Otof APN 5 30,528,070 (GRCm39) missense probably benign 0.23
IGL02077:Otof APN 5 30,556,579 (GRCm39) missense probably damaging 1.00
IGL02136:Otof APN 5 30,531,336 (GRCm39) missense possibly damaging 0.90
IGL02227:Otof APN 5 30,528,128 (GRCm39) missense probably damaging 1.00
IGL02475:Otof APN 5 30,534,026 (GRCm39) missense probably damaging 1.00
IGL02812:Otof APN 5 30,531,426 (GRCm39) missense probably benign 0.08
IGL02864:Otof APN 5 30,543,685 (GRCm39) missense probably damaging 0.99
IGL03176:Otof APN 5 30,562,520 (GRCm39) splice site probably null
R0285:Otof UTSW 5 30,536,877 (GRCm39) critical splice donor site probably null
R0421:Otof UTSW 5 30,528,912 (GRCm39) missense possibly damaging 0.94
R0570:Otof UTSW 5 30,529,225 (GRCm39) splice site probably benign
R0599:Otof UTSW 5 30,528,049 (GRCm39) missense probably damaging 1.00
R0675:Otof UTSW 5 30,539,705 (GRCm39) missense probably benign 0.01
R0715:Otof UTSW 5 30,552,041 (GRCm39) missense probably damaging 0.99
R1019:Otof UTSW 5 30,528,087 (GRCm39) missense probably damaging 0.96
R1183:Otof UTSW 5 30,529,256 (GRCm39) missense probably damaging 1.00
R1435:Otof UTSW 5 30,536,039 (GRCm39) missense probably benign 0.00
R1469:Otof UTSW 5 30,537,571 (GRCm39) missense probably benign 0.00
R1469:Otof UTSW 5 30,537,571 (GRCm39) missense probably benign 0.00
R1474:Otof UTSW 5 30,536,876 (GRCm39) critical splice donor site probably null
R1524:Otof UTSW 5 30,536,900 (GRCm39) missense probably benign 0.03
R1563:Otof UTSW 5 30,528,349 (GRCm39) missense probably benign 0.00
R1732:Otof UTSW 5 30,543,815 (GRCm39) missense probably damaging 1.00
R1822:Otof UTSW 5 30,536,054 (GRCm39) missense probably benign 0.00
R1845:Otof UTSW 5 30,529,067 (GRCm39) nonsense probably null
R1925:Otof UTSW 5 30,551,532 (GRCm39) missense probably benign 0.37
R1938:Otof UTSW 5 30,533,713 (GRCm39) missense probably benign 0.00
R1968:Otof UTSW 5 30,545,998 (GRCm39) missense probably damaging 1.00
R1996:Otof UTSW 5 30,578,381 (GRCm39) missense probably benign 0.01
R1999:Otof UTSW 5 30,546,116 (GRCm39) missense probably benign 0.19
R2027:Otof UTSW 5 30,578,358 (GRCm39) missense probably benign 0.08
R2138:Otof UTSW 5 30,619,114 (GRCm39) missense probably benign 0.01
R2173:Otof UTSW 5 30,543,718 (GRCm39) missense probably damaging 1.00
R2245:Otof UTSW 5 30,527,551 (GRCm39) missense probably damaging 1.00
R3011:Otof UTSW 5 30,540,184 (GRCm39) missense probably damaging 1.00
R3105:Otof UTSW 5 30,539,145 (GRCm39) missense probably benign 0.03
R3442:Otof UTSW 5 30,529,033 (GRCm39) missense probably damaging 1.00
R3710:Otof UTSW 5 30,542,610 (GRCm39) missense probably benign
R3715:Otof UTSW 5 30,534,215 (GRCm39) nonsense probably null
R3806:Otof UTSW 5 30,543,843 (GRCm39) critical splice acceptor site probably null
R3975:Otof UTSW 5 30,528,056 (GRCm39) missense probably damaging 1.00
R4067:Otof UTSW 5 30,556,635 (GRCm39) missense probably damaging 1.00
R4077:Otof UTSW 5 30,576,850 (GRCm39) missense possibly damaging 0.89
R4166:Otof UTSW 5 30,539,762 (GRCm39) missense probably damaging 1.00
R4451:Otof UTSW 5 30,542,508 (GRCm39) missense possibly damaging 0.77
R4485:Otof UTSW 5 30,532,344 (GRCm39) missense possibly damaging 0.77
R4600:Otof UTSW 5 30,529,244 (GRCm39) missense probably damaging 1.00
R4646:Otof UTSW 5 30,540,914 (GRCm39) missense possibly damaging 0.82
R4648:Otof UTSW 5 30,540,914 (GRCm39) missense possibly damaging 0.82
R4669:Otof UTSW 5 30,578,318 (GRCm39) critical splice donor site probably null
R4773:Otof UTSW 5 30,552,026 (GRCm39) missense probably benign 0.05
R4839:Otof UTSW 5 30,576,748 (GRCm39) missense probably damaging 0.99
R4907:Otof UTSW 5 30,536,005 (GRCm39) critical splice donor site probably null
R4961:Otof UTSW 5 30,540,837 (GRCm39) intron probably benign
R4991:Otof UTSW 5 30,551,525 (GRCm39) missense probably damaging 1.00
R5015:Otof UTSW 5 30,540,238 (GRCm39) missense probably damaging 1.00
R5036:Otof UTSW 5 30,541,783 (GRCm39) missense possibly damaging 0.54
R5038:Otof UTSW 5 30,541,783 (GRCm39) missense possibly damaging 0.54
R5253:Otof UTSW 5 30,527,483 (GRCm39) missense probably damaging 1.00
R5336:Otof UTSW 5 30,534,064 (GRCm39) missense probably benign 0.01
R5901:Otof UTSW 5 30,532,323 (GRCm39) missense probably damaging 1.00
R6211:Otof UTSW 5 30,529,244 (GRCm39) missense probably damaging 0.99
R6318:Otof UTSW 5 30,571,888 (GRCm39) missense probably damaging 1.00
R6331:Otof UTSW 5 30,529,279 (GRCm39) missense possibly damaging 0.94
R6671:Otof UTSW 5 30,576,877 (GRCm39) missense probably benign
R6701:Otof UTSW 5 30,528,141 (GRCm39) nonsense probably null
R6792:Otof UTSW 5 30,532,978 (GRCm39) missense probably damaging 1.00
R6853:Otof UTSW 5 30,545,583 (GRCm39) missense probably damaging 1.00
R6940:Otof UTSW 5 30,528,987 (GRCm39) missense probably damaging 0.96
R7037:Otof UTSW 5 30,538,882 (GRCm39) missense probably benign 0.32
R7060:Otof UTSW 5 30,545,700 (GRCm39) missense possibly damaging 0.84
R7089:Otof UTSW 5 30,528,912 (GRCm39) missense possibly damaging 0.94
R7165:Otof UTSW 5 30,532,964 (GRCm39) missense probably damaging 0.99
R7178:Otof UTSW 5 30,540,878 (GRCm39) missense possibly damaging 0.50
R7298:Otof UTSW 5 30,545,614 (GRCm39) missense probably damaging 1.00
R7393:Otof UTSW 5 30,527,614 (GRCm39) missense probably benign 0.45
R7397:Otof UTSW 5 30,533,051 (GRCm39) missense probably damaging 1.00
R7400:Otof UTSW 5 30,542,532 (GRCm39) missense probably benign 0.04
R7428:Otof UTSW 5 30,547,169 (GRCm39) missense probably damaging 1.00
R7456:Otof UTSW 5 30,552,005 (GRCm39) missense probably damaging 1.00
R7505:Otof UTSW 5 30,528,364 (GRCm39) missense probably benign 0.00
R7714:Otof UTSW 5 30,527,597 (GRCm39) missense probably damaging 0.99
R8002:Otof UTSW 5 30,537,954 (GRCm39) missense probably benign 0.10
R8032:Otof UTSW 5 30,619,142 (GRCm39) start codon destroyed probably benign 0.07
R8153:Otof UTSW 5 30,546,079 (GRCm39) missense probably damaging 1.00
R8158:Otof UTSW 5 30,537,538 (GRCm39) missense probably benign 0.37
R8159:Otof UTSW 5 30,537,538 (GRCm39) missense probably benign 0.37
R8441:Otof UTSW 5 30,538,200 (GRCm39) missense probably damaging 0.99
R8738:Otof UTSW 5 30,545,968 (GRCm39) nonsense probably null
R8813:Otof UTSW 5 30,540,242 (GRCm39) missense probably benign 0.02
R8835:Otof UTSW 5 30,528,264 (GRCm39) missense probably benign 0.44
R8852:Otof UTSW 5 30,529,044 (GRCm39) missense possibly damaging 0.94
R8869:Otof UTSW 5 30,578,325 (GRCm39) missense probably benign 0.08
R9029:Otof UTSW 5 30,527,419 (GRCm39) critical splice donor site probably null
R9031:Otof UTSW 5 30,537,532 (GRCm39) missense probably benign
R9061:Otof UTSW 5 30,546,001 (GRCm39) missense possibly damaging 0.50
R9100:Otof UTSW 5 30,539,696 (GRCm39) missense possibly damaging 0.80
R9121:Otof UTSW 5 30,536,462 (GRCm39) missense probably benign 0.04
R9188:Otof UTSW 5 30,534,095 (GRCm39) missense probably damaging 1.00
R9218:Otof UTSW 5 30,542,469 (GRCm39) missense probably benign
R9280:Otof UTSW 5 30,528,894 (GRCm39) missense probably damaging 0.98
R9395:Otof UTSW 5 30,532,976 (GRCm39) missense probably damaging 1.00
R9400:Otof UTSW 5 30,540,863 (GRCm39) critical splice donor site probably null
R9407:Otof UTSW 5 30,538,265 (GRCm39) missense probably damaging 1.00
R9616:Otof UTSW 5 30,539,708 (GRCm39) missense possibly damaging 0.95
R9665:Otof UTSW 5 30,584,895 (GRCm39) missense probably benign 0.22
R9748:Otof UTSW 5 30,540,998 (GRCm39) missense probably damaging 1.00
R9783:Otof UTSW 5 30,536,576 (GRCm39) missense probably benign
Z1176:Otof UTSW 5 30,528,930 (GRCm39) missense probably damaging 0.98
Z1177:Otof UTSW 5 30,541,002 (GRCm39) missense probably damaging 1.00
Z1177:Otof UTSW 5 30,533,641 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAATCTCAGTGGCGAGCCC -3'
(R):5'- TTTCCATGGAGATTCTAGAGTGGAG -3'

Sequencing Primer
(F):5'- CCCAGGGAGAGGGGTCC -3'
(R):5'- GATCAGGAGAGGCCAACGC -3'
Posted On 2016-08-04