Incidental Mutation 'R5365:Sbno1'
ID423077
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Namestrawberry notch 1
Synonyms9330180L10Rik, sno
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5365 (G1)
Quality Score217
Status Not validated
Chromosome5
Chromosomal Location124368702-124426001 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCC to TCC at 124381866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000199808]
Predicted Effect probably null
Transcript: ENSMUST00000065263
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168651
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199245
Predicted Effect probably null
Transcript: ENSMUST00000199808
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124402205 missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124410249 missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124381706 missense probably benign 0.41
IGL01330:Sbno1 APN 5 124391979 missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124378555 splice site probably benign
IGL01800:Sbno1 APN 5 124381505 splice site probably benign
IGL01987:Sbno1 APN 5 124404219 missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124400195 splice site probably null
IGL02544:Sbno1 APN 5 124403983 missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124381677 splice site probably benign
IGL02592:Sbno1 APN 5 124400809 missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124376150 missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124387311 splice site probably benign
IGL03131:Sbno1 APN 5 124388605 missense probably damaging 1.00
Decrement UTSW 5 124400847 missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124404324 critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124386868 missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124410285 missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124410139 missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124386892 missense possibly damaging 0.79
R0655:Sbno1 UTSW 5 124376149 missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124393912 missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124384460 splice site probably benign
R1522:Sbno1 UTSW 5 124392612 missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124384504 missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124404216 missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124392067 splice site probably null
R1779:Sbno1 UTSW 5 124388517 unclassified probably benign
R2103:Sbno1 UTSW 5 124393937 missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124387534 synonymous probably null
R2149:Sbno1 UTSW 5 124402119 synonymous probably null
R2153:Sbno1 UTSW 5 124378543 missense probably benign
R2154:Sbno1 UTSW 5 124378511 missense probably benign
R2231:Sbno1 UTSW 5 124405704 missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124381708 missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124381930 missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124391920 critical splice donor site probably null
R4612:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124374609 missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124400165 missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124408475 critical splice donor site probably null
R5399:Sbno1 UTSW 5 124392741 missense probably benign 0.09
R5704:Sbno1 UTSW 5 124395893 critical splice donor site probably null
R5898:Sbno1 UTSW 5 124386791 intron probably benign
R6136:Sbno1 UTSW 5 124378491 missense probably benign 0.41
R6154:Sbno1 UTSW 5 124378479 missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124392714 missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124395931 missense probably benign 0.28
R6454:Sbno1 UTSW 5 124400847 missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124381720 missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124392881 missense probably benign 0.21
R7219:Sbno1 UTSW 5 124405659 missense probably benign 0.00
R7535:Sbno1 UTSW 5 124413279 missense possibly damaging 0.48
R7673:Sbno1 UTSW 5 124413216 missense probably benign
R7692:Sbno1 UTSW 5 124405646 missense probably benign 0.35
R7745:Sbno1 UTSW 5 124392899 missense probably benign 0.00
R7762:Sbno1 UTSW 5 124374666 missense probably benign 0.19
Z1088:Sbno1 UTSW 5 124393958 missense possibly damaging 0.91
Z1088:Sbno1 UTSW 5 124404304 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGTGTATAACTCTACATGGCCG -3'
(R):5'- GAAACTTTGAAGGTTTGCTTAGCTG -3'

Sequencing Primer
(F):5'- CCCAGATCTTAAGGCACA -3'
(R):5'- AGGTTTGCTTAGCTGAAGAATAAG -3'
Posted On2016-08-04