Incidental Mutation 'R5365:Cyp3a16'
ID423078
Institutional Source Beutler Lab
Gene Symbol Cyp3a16
Ensembl Gene ENSMUSG00000038656
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 16
Synonyms
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145436309-145469723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 145452787 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 256 (M256R)
Ref Sequence ENSEMBL: ENSMUSP00000031633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031633]
Predicted Effect probably damaging
Transcript: ENSMUST00000031633
AA Change: M256R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031633
Gene: ENSMUSG00000038656
AA Change: M256R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 5.5e-132 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Cyp3a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Cyp3a16 APN 5 145440434 missense probably damaging 0.98
IGL01964:Cyp3a16 APN 5 145455562 missense probably benign 0.41
IGL02007:Cyp3a16 APN 5 145441948 splice site probably benign
IGL02139:Cyp3a16 APN 5 145455480 missense probably benign 0.10
IGL02177:Cyp3a16 APN 5 145450154 missense probably benign 0.43
IGL02407:Cyp3a16 APN 5 145451842 missense probably damaging 0.99
IGL02473:Cyp3a16 APN 5 145440494 missense possibly damaging 0.54
polywog UTSW 5 145467470 nonsense probably null
R0363:Cyp3a16 UTSW 5 145455879 splice site probably benign
R0556:Cyp3a16 UTSW 5 145455980 missense probably benign 0.37
R0557:Cyp3a16 UTSW 5 145469588 missense unknown
R0636:Cyp3a16 UTSW 5 145463085 missense probably benign 0.03
R0749:Cyp3a16 UTSW 5 145456177 critical splice acceptor site probably null
R0788:Cyp3a16 UTSW 5 145465076 missense probably benign 0.00
R1552:Cyp3a16 UTSW 5 145436536 missense probably benign 0.01
R1575:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R1580:Cyp3a16 UTSW 5 145442074 missense possibly damaging 0.94
R1580:Cyp3a16 UTSW 5 145442075 missense probably damaging 1.00
R1642:Cyp3a16 UTSW 5 145469589 missense unknown
R1763:Cyp3a16 UTSW 5 145465031 critical splice donor site probably null
R2029:Cyp3a16 UTSW 5 145451857 missense probably damaging 0.96
R2144:Cyp3a16 UTSW 5 145456084 missense probably damaging 1.00
R2409:Cyp3a16 UTSW 5 145440367 missense probably benign 0.01
R2473:Cyp3a16 UTSW 5 145455594 missense possibly damaging 0.79
R2860:Cyp3a16 UTSW 5 145455499 nonsense probably null
R2861:Cyp3a16 UTSW 5 145455499 nonsense probably null
R3747:Cyp3a16 UTSW 5 145442071 missense probably damaging 1.00
R4654:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R4781:Cyp3a16 UTSW 5 145456112 missense possibly damaging 0.85
R4873:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4875:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4925:Cyp3a16 UTSW 5 145452834 missense probably benign 0.00
R5496:Cyp3a16 UTSW 5 145467531 missense probably damaging 1.00
R5640:Cyp3a16 UTSW 5 145452823 missense possibly damaging 0.94
R5761:Cyp3a16 UTSW 5 145442033 missense possibly damaging 0.79
R6401:Cyp3a16 UTSW 5 145440364 missense probably damaging 1.00
R6526:Cyp3a16 UTSW 5 145455895 missense probably benign 0.01
R6528:Cyp3a16 UTSW 5 145440431 missense probably damaging 1.00
R7000:Cyp3a16 UTSW 5 145463170 critical splice acceptor site probably null
R7268:Cyp3a16 UTSW 5 145467470 nonsense probably null
R7630:Cyp3a16 UTSW 5 145436310 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTAAAACTCCAACTTCTCCTCCATGAG -3'
(R):5'- CCCAGTGTGAGCAAGTTCAC -3'

Sequencing Primer
(F):5'- CACAGCCTACATGTTCAC -3'
(R):5'- TTCACAGAGAGAGTGACTTCTG -3'
Posted On2016-08-04