Incidental Mutation 'R5365:Igkv9-120'
ID423079
Institutional Source Beutler Lab
Gene Symbol Igkv9-120
Ensembl Gene ENSMUSG00000094872
Gene Nameimmunoglobulin kappa chain variable 9-120
SynonymsGm5571
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location68049983-68050454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68050449 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Ref Sequence ENSEMBL: ENSMUSP00000100117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103316]
Predicted Effect probably benign
Transcript: ENSMUST00000103316
AA Change: S116P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100117
Gene: ENSMUSG00000094872
AA Change: S116P

DomainStartEndE-ValueType
IGv 40 112 9.99e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Igkv9-120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Igkv9-120 APN 6 68049987 missense possibly damaging 0.67
IGL02248:Igkv9-120 APN 6 68050237 missense probably damaging 1.00
IGL02410:Igkv9-120 APN 6 68050043 splice site probably benign
IGL03093:Igkv9-120 APN 6 68050414 missense probably damaging 1.00
R2847:Igkv9-120 UTSW 6 68050144 splice site probably benign
R2848:Igkv9-120 UTSW 6 68050144 splice site probably benign
R3749:Igkv9-120 UTSW 6 68050001 missense probably benign 0.04
R3889:Igkv9-120 UTSW 6 68050378 missense probably damaging 1.00
R4235:Igkv9-120 UTSW 6 68050333 missense probably benign
R4270:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4760:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4767:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4768:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4769:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R5671:Igkv9-120 UTSW 6 68050273 nonsense probably null
R7749:Igkv9-120 UTSW 6 68050188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCAGTCTCACTTGTCGG -3'
(R):5'- CCTTCCAGAAGCATTGCATATGTG -3'

Sequencing Primer
(F):5'- GCTTAAACTGGCTTCAGCAG -3'
(R):5'- GTATTTTGTGTCTTAGGAGTCACCCC -3'
Posted On2016-08-04