Incidental Mutation 'R5365:Ces2e'
ID423087
Institutional Source Beutler Lab
Gene Symbol Ces2e
Ensembl Gene ENSMUSG00000031886
Gene Namecarboxylesterase 2E
Synonyms9030624L02Rik, Ces5
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104926260-104934672 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 104927214 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034355] [ENSMUST00000109410]
Predicted Effect probably null
Transcript: ENSMUST00000034355
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109410
SMART Domains Protein: ENSMUSP00000105037
Gene: ENSMUSG00000031886

DomainStartEndE-ValueType
Pfam:COesterase 9 538 1.7e-171 PFAM
Pfam:Abhydrolase_3 143 246 6.6e-11 PFAM
Pfam:Peptidase_S9 158 276 2.1e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Ces2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Ces2e APN 8 104929565 missense probably benign 0.42
IGL02045:Ces2e APN 8 104930658 splice site probably benign
IGL02656:Ces2e APN 8 104927056 missense possibly damaging 0.94
IGL02904:Ces2e APN 8 104931338 missense probably benign
IGL02972:Ces2e APN 8 104927061 missense probably damaging 1.00
IGL03244:Ces2e APN 8 104928819 missense probably benign 0.38
R0585:Ces2e UTSW 8 104929821 missense probably damaging 1.00
R0762:Ces2e UTSW 8 104929864 missense probably damaging 0.98
R1004:Ces2e UTSW 8 104929738 missense probably damaging 1.00
R1168:Ces2e UTSW 8 104927014 missense possibly damaging 0.49
R1731:Ces2e UTSW 8 104929576 missense probably damaging 1.00
R2134:Ces2e UTSW 8 104932539 critical splice donor site probably null
R3087:Ces2e UTSW 8 104930715 missense probably benign 0.18
R3693:Ces2e UTSW 8 104928811 missense probably damaging 1.00
R4622:Ces2e UTSW 8 104928709 intron probably null
R4873:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4875:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4965:Ces2e UTSW 8 104933698 missense probably benign 0.09
R5529:Ces2e UTSW 8 104929911 missense probably benign 0.00
R5601:Ces2e UTSW 8 104929494 missense probably benign 0.42
R5968:Ces2e UTSW 8 104932995 missense probably damaging 1.00
R6128:Ces2e UTSW 8 104928796 missense probably benign 0.03
R7337:Ces2e UTSW 8 104931056 splice site probably null
R7363:Ces2e UTSW 8 104933000 splice site probably null
R7489:Ces2e UTSW 8 104929780 missense probably benign 0.26
R7548:Ces2e UTSW 8 104931906 missense probably benign
Z1088:Ces2e UTSW 8 104931347 missense probably benign
Z1088:Ces2e UTSW 8 104932398 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAACCATGTTGGCATCTCCAC -3'
(R):5'- CTGATCTTTGACCCAGGAGAC -3'

Sequencing Primer
(F):5'- ATGTTGGCATCTCCACCCACAG -3'
(R):5'- ACGCACTGCACATCATAG -3'
Posted On2016-08-04