Mutagenetix > Incidental Mutations

Incidental Mutation 'R5365:Tgm4'

423088

Institutional Source

Beutler Lab

Gene Symbol

Tgm4

Ensembl Gene

ENSMUSG00000025787

Gene Name

transglutaminase 4 (prostate)

Synonyms

9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1

MMRRC Submission

042943-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R5365 (G1)

Quality Score

202

Status

Not validated

Chromosome

Chromosomal Location

123034726-123067561 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 123066801 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 223 (K223N)

Ref Sequence

ENSEMBL: ENSMUSP00000149120 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000140497] [ENSMUST00000215247]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026893
AA Change: K647N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: K647N

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	8	118	4e-26	PFAM
TGc	247	340	6.25e-42	SMART
Pfam:Transglut_C	573	670	3e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140497

SMART Domains

Protein: ENSMUSP00000122604
Gene: ENSMUSG00000025786

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
transmembrane domain	46	68	N/A	INTRINSIC
transmembrane domain	73	95	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214552

Predicted Effect

probably damaging
Transcript: ENSMUST00000215247
AA Change: K223N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,628,629	E4877G	probably damaging	Het
Acss3	C	T	10: 107,004,728	A391T	probably damaging	Het
Bcan	T	C	3: 87,989,235	Y718C	probably damaging	Het
Bnc2	T	C	4: 84,411,429		probably benign	Het
Card6	A	G	15: 5,105,406	V105A	possibly damaging	Het
Ceacam5	A	G	7: 17,759,548	Y832C	probably damaging	Het
Ces2e	T	C	8: 104,927,214		probably null	Het
Cpt1b	A	T	15: 89,420,107	I480N	possibly damaging	Het
Csmd3	T	C	15: 48,004,749	T792A	possibly damaging	Het
Ctsq	T	A	13: 61,037,818	I170F	possibly damaging	Het
Cyfip2	A	G	11: 46,247,630	S772P	probably damaging	Het
Cyp3a16	A	C	5: 145,452,787	M256R	probably damaging	Het
Dgkd	C	T	1: 87,935,416	R62C	probably damaging	Het
Ephx3	A	G	17: 32,189,249	L67P	probably damaging	Het
Gpc2	A	G	5: 138,275,623	Y438H	probably damaging	Het
Hnrnpul2	T	A	19: 8,820,716	H145Q	probably benign	Het
Igkv9-120	T	C	6: 68,050,449	S116P	probably benign	Het
Impad1	G	A	4: 4,776,385	T190I	probably damaging	Het
Itgal	A	G	7: 127,305,350	I332V	probably damaging	Het
Lrit1	A	G	14: 37,062,142	T476A	probably benign	Het
Lrp1b	T	C	2: 40,647,125	H50R	possibly damaging	Het
March7	T	C	2: 60,233,914	V178A	possibly damaging	Het
Mbtps2	G	A	X: 157,568,299	T157M	possibly damaging	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mill2	T	C	7: 18,858,414	V320A	probably benign	Het
Mtor	G	A	4: 148,550,130	V2403M	probably damaging	Het
Nectin3	T	A	16: 46,464,106	K71*	probably null	Het
Olfr117	T	A	17: 37,659,695	I213F	probably damaging	Het
Otof	T	C	5: 30,381,800	Y1090C	probably damaging	Het
Pigf	A	T	17: 87,023,708	V62E	possibly damaging	Het
Pla1a	A	G	16: 38,417,207	L43P	probably benign	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Sbno1	TCCC	TCC	5: 124,381,866		probably null	Het
Ttn	G	T	2: 76,914,646	A5353E	probably damaging	Het
Ywhaq	T	C	12: 21,396,388	E159G	possibly damaging	Het
Zdhhc12	A	G	2: 30,093,509	V27A	probably damaging	Het

Other mutations in Tgm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Tgm4	APN	9	123062382	unclassified	probably benign
IGL01402:Tgm4	APN	9	123051454	missense	possibly damaging	0.82
IGL02000:Tgm4	APN	9	123056466	missense	probably damaging	1.00
IGL02120:Tgm4	APN	9	123046529	missense	probably damaging	0.98
IGL03130:Tgm4	APN	9	123056515	missense	probably damaging	1.00
IGL03188:Tgm4	APN	9	123045036	missense	probably null	0.06
R0329:Tgm4	UTSW	9	123048557	critical splice donor site	probably null
R0480:Tgm4	UTSW	9	123062419	missense	probably benign
R0644:Tgm4	UTSW	9	123051458	missense	probably damaging	1.00
R0990:Tgm4	UTSW	9	123046511	missense	probably benign	0.02
R1604:Tgm4	UTSW	9	123045064	missense	probably benign	0.39
R1644:Tgm4	UTSW	9	123051416	missense	probably damaging	1.00
R2056:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2058:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2059:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2076:Tgm4	UTSW	9	123051095	missense	probably benign	0.24
R2437:Tgm4	UTSW	9	123048549	nonsense	probably null
R4392:Tgm4	UTSW	9	123066752	missense	probably benign	0.10
R4407:Tgm4	UTSW	9	123056530	missense	probably damaging	1.00
R4752:Tgm4	UTSW	9	123051386	missense	probably damaging	1.00
R5288:Tgm4	UTSW	9	123056494	missense	probably damaging	1.00
R5386:Tgm4	UTSW	9	123056494	missense	probably damaging	1.00
R5790:Tgm4	UTSW	9	123061743	missense	probably damaging	0.98
R5890:Tgm4	UTSW	9	123061638	missense	probably damaging	1.00
R6102:Tgm4	UTSW	9	123056535	missense	probably benign
R6358:Tgm4	UTSW	9	123056518	missense	probably damaging	1.00
R6956:Tgm4	UTSW	9	123064703	missense	possibly damaging	0.93
R6966:Tgm4	UTSW	9	123051142	missense	possibly damaging	0.68
R7091:Tgm4	UTSW	9	123040460	missense	probably damaging	1.00
R7258:Tgm4	UTSW	9	123062491	missense	probably benign	0.02
R7313:Tgm4	UTSW	9	123062491	missense	probably benign	0.02
R7369:Tgm4	UTSW	9	123056684	critical splice donor site	probably null
R7802:Tgm4	UTSW	9	123051336	intron	probably benign
R8219:Tgm4	UTSW	9	123045052	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACAGCTGAGACAAGTGGCC -3'
(R):5'- TCCCTGACCTGAAAGCTAAATG -3'

Sequencing Primer
(F):5'- TGCAGCACAGGGATTTCC -3'
(R):5'- AACATGCTTAGCCAAGGC -3'

Posted On

2016-08-04