Incidental Mutation 'R5365:Ywhaq'
ID423094
Institutional Source Beutler Lab
Gene Symbol Ywhaq
Ensembl Gene ENSMUSG00000076432
Gene Nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta
Synonyms2700028P07Rik, 14-3-3 tau, 14-3-3 theta
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R5365 (G1)
Quality Score190
Status Not validated
Chromosome12
Chromosomal Location21390071-21417637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21396388 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 159 (E159G)
Ref Sequence ENSEMBL: ENSMUSP00000123605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049531] [ENSMUST00000103002] [ENSMUST00000135088] [ENSMUST00000155480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049531
AA Change: E159G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106602
Gene: ENSMUSG00000076432
AA Change: E159G

DomainStartEndE-ValueType
14_3_3 3 242 6.88e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103002
AA Change: E159G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100067
Gene: ENSMUSG00000076432
AA Change: E159G

DomainStartEndE-ValueType
14_3_3 3 242 6.88e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135088
AA Change: E159G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123605
Gene: ENSMUSG00000076432
AA Change: E159G

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
14_3_3 61 300 6.88e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146206
Predicted Effect possibly damaging
Transcript: ENSMUST00000155480
AA Change: E159G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117118
Gene: ENSMUSG00000076432
AA Change: E159G

DomainStartEndE-ValueType
14_3_3 3 237 1.41e-124 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele are developmentally delayed and die by E14 with no specific cardiac defects; however, heterozygotes develop larger myocardial infarctions with increased post-infarction cardiac remodeling while cultured cardiomyocytes are sensitized to proapoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Ywhaq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02893:Ywhaq APN 12 21396409 missense probably damaging 1.00
IGL03240:Ywhaq APN 12 21395000 missense possibly damaging 0.68
R0423:Ywhaq UTSW 12 21391381 utr 3 prime probably benign
R1172:Ywhaq UTSW 12 21395023 missense probably benign 0.00
R4821:Ywhaq UTSW 12 21417511 utr 5 prime probably benign
R6959:Ywhaq UTSW 12 21396280 critical splice donor site probably null
R7022:Ywhaq UTSW 12 21391751 intron probably benign
R7183:Ywhaq UTSW 12 21416869 missense possibly damaging 0.91
R7320:Ywhaq UTSW 12 21394981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGAAAATGGCCTCCCTTG -3'
(R):5'- TAAGTATACTGGAGCTGTGGTGATC -3'

Sequencing Primer
(F):5'- GAAAATGGCCTCCCTTGAGCATC -3'
(R):5'- CTGTGGTGATCAGAATGACTCATAGC -3'
Posted On2016-08-04