Incidental Mutation 'R5365:Cpt1b'
ID423100
Institutional Source Beutler Lab
Gene Symbol Cpt1b
Ensembl Gene ENSMUSG00000078937
Gene Namecarnitine palmitoyltransferase 1b, muscle
SynonymsM-CPTI, M-CPT I, Cpt1
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89416405-89425863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89420107 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 480 (I480N)
Ref Sequence ENSEMBL: ENSMUSP00000104936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376]
Predicted Effect probably benign
Transcript: ENSMUST00000052315
Predicted Effect possibly damaging
Transcript: ENSMUST00000109313
AA Change: I480N

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937
AA Change: I480N

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165419
Predicted Effect probably benign
Transcript: ENSMUST00000168376
SMART Domains Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
PDB:2LE3|A 1 42 1e-21 PDB
Predicted Effect unknown
Transcript: ENSMUST00000168879
AA Change: I110N
SMART Domains Protein: ENSMUSP00000128188
Gene: ENSMUSG00000078937
AA Change: I110N

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 3 148 3.5e-34 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice die in utero prior to E9.5. Heterozygous mutant mice exhibit susceptibility to fatal hypothermia following cold exposure, with females more severely affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Cpt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cpt1b APN 15 89420863 missense probably benign 0.01
IGL00497:Cpt1b APN 15 89422293 missense probably benign 0.22
IGL01142:Cpt1b APN 15 89418993 missense probably benign
IGL02329:Cpt1b APN 15 89423739 missense probably benign
IGL02740:Cpt1b APN 15 89424332 missense probably damaging 1.00
IGL03196:Cpt1b APN 15 89424395 missense probably benign
oleagenous UTSW 15 89425214 missense probably damaging 1.00
IGL02796:Cpt1b UTSW 15 89424802 missense probably benign 0.04
PIT4519001:Cpt1b UTSW 15 89418863 missense probably damaging 1.00
R0276:Cpt1b UTSW 15 89419959 missense probably benign 0.12
R0302:Cpt1b UTSW 15 89417870 missense probably benign
R0454:Cpt1b UTSW 15 89424393 missense possibly damaging 0.47
R1199:Cpt1b UTSW 15 89419010 missense probably benign 0.01
R1633:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
R1674:Cpt1b UTSW 15 89422332 missense possibly damaging 0.64
R2087:Cpt1b UTSW 15 89422208 missense probably benign 0.07
R2178:Cpt1b UTSW 15 89419043 missense probably damaging 1.00
R2414:Cpt1b UTSW 15 89420080 splice site probably benign
R2507:Cpt1b UTSW 15 89419098 missense probably benign 0.08
R2883:Cpt1b UTSW 15 89417869 missense probably benign 0.00
R3432:Cpt1b UTSW 15 89423741 missense possibly damaging 0.85
R3783:Cpt1b UTSW 15 89425189 missense probably damaging 1.00
R4574:Cpt1b UTSW 15 89424044 splice site probably null
R4737:Cpt1b UTSW 15 89421406 missense probably benign 0.03
R5122:Cpt1b UTSW 15 89424023 missense probably benign 0.09
R5320:Cpt1b UTSW 15 89419274 missense probably benign 0.00
R5699:Cpt1b UTSW 15 89424273 missense probably benign 0.44
R5710:Cpt1b UTSW 15 89425206 missense probably damaging 1.00
R5873:Cpt1b UTSW 15 89420728 missense probably damaging 1.00
R5941:Cpt1b UTSW 15 89425214 missense probably damaging 1.00
R6163:Cpt1b UTSW 15 89424417 missense probably benign 0.15
R6197:Cpt1b UTSW 15 89424834 missense possibly damaging 0.77
R6323:Cpt1b UTSW 15 89419063 missense probably benign 0.10
R6486:Cpt1b UTSW 15 89420824 missense probably benign
R7571:Cpt1b UTSW 15 89421343 critical splice donor site probably null
R7648:Cpt1b UTSW 15 89421367 missense probably damaging 1.00
R7743:Cpt1b UTSW 15 89421404 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TAGCCTGTATACCTGCTCGG -3'
(R):5'- TGGATCATGAGTGTTAGCCGTATAG -3'

Sequencing Primer
(F):5'- GTATACCTGCTCGGGAATGTCC -3'
(R):5'- CCGTATAGGGGTAGGGCAGC -3'
Posted On2016-08-04