Incidental Mutation 'R5365:Cpt1b'
ID 423100
Institutional Source Beutler Lab
Gene Symbol Cpt1b
Ensembl Gene ENSMUSG00000078937
Gene Name carnitine palmitoyltransferase 1b, muscle
Synonyms Cpt1, M-CPTI, M-CPT I
MMRRC Submission 042943-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5365 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 89300608-89310065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89304310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 480 (I480N)
Ref Sequence ENSEMBL: ENSMUSP00000104936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052315] [ENSMUST00000109313] [ENSMUST00000168376]
AlphaFold Q924X2
Predicted Effect probably benign
Transcript: ENSMUST00000052315
Predicted Effect possibly damaging
Transcript: ENSMUST00000109313
AA Change: I480N

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937
AA Change: I480N

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165419
Predicted Effect probably benign
Transcript: ENSMUST00000168376
SMART Domains Protein: ENSMUSP00000129786
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
PDB:2LE3|A 1 42 1e-21 PDB
Predicted Effect unknown
Transcript: ENSMUST00000168879
AA Change: I110N
SMART Domains Protein: ENSMUSP00000128188
Gene: ENSMUSG00000078937
AA Change: I110N

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 3 148 3.5e-34 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice die in utero prior to E9.5. Heterozygous mutant mice exhibit susceptibility to fatal hypothermia following cold exposure, with females more severely affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,578,629 (GRCm39) E4877G probably damaging Het
Acss3 C T 10: 106,840,589 (GRCm39) A391T probably damaging Het
Bcan T C 3: 87,896,542 (GRCm39) Y718C probably damaging Het
Bnc2 T C 4: 84,329,666 (GRCm39) probably benign Het
Bpnt2 G A 4: 4,776,385 (GRCm39) T190I probably damaging Het
Card6 A G 15: 5,134,888 (GRCm39) V105A possibly damaging Het
Ceacam5 A G 7: 17,493,473 (GRCm39) Y832C probably damaging Het
Ces2e T C 8: 105,653,846 (GRCm39) probably null Het
Csmd3 T C 15: 47,868,145 (GRCm39) T792A possibly damaging Het
Ctsq T A 13: 61,185,632 (GRCm39) I170F possibly damaging Het
Cyfip2 A G 11: 46,138,457 (GRCm39) S772P probably damaging Het
Cyp3a16 A C 5: 145,389,597 (GRCm39) M256R probably damaging Het
Dgkd C T 1: 87,863,138 (GRCm39) R62C probably damaging Het
Ephx3 A G 17: 32,408,223 (GRCm39) L67P probably damaging Het
Gpc2 A G 5: 138,273,885 (GRCm39) Y438H probably damaging Het
Hnrnpul2 T A 19: 8,798,080 (GRCm39) H145Q probably benign Het
Igkv9-120 T C 6: 68,027,433 (GRCm39) S116P probably benign Het
Itgal A G 7: 126,904,522 (GRCm39) I332V probably damaging Het
Lrit1 A G 14: 36,784,099 (GRCm39) T476A probably benign Het
Lrp1b T C 2: 40,537,137 (GRCm39) H50R possibly damaging Het
Marchf7 T C 2: 60,064,258 (GRCm39) V178A possibly damaging Het
Mbtps2 G A X: 156,351,295 (GRCm39) T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 (GRCm39) P2542L probably damaging Het
Mill2 T C 7: 18,592,339 (GRCm39) V320A probably benign Het
Mtor G A 4: 148,634,587 (GRCm39) V2403M probably damaging Het
Nectin3 T A 16: 46,284,469 (GRCm39) K71* probably null Het
Or2g25 T A 17: 37,970,586 (GRCm39) I213F probably damaging Het
Otof T C 5: 30,539,144 (GRCm39) Y1090C probably damaging Het
Pigf A T 17: 87,331,136 (GRCm39) V62E possibly damaging Het
Pla1a A G 16: 38,237,569 (GRCm39) L43P probably benign Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,519,929 (GRCm39) probably null Het
Tgm4 A C 9: 122,895,866 (GRCm39) K223N probably damaging Het
Ttn G T 2: 76,744,990 (GRCm39) A5353E probably damaging Het
Ywhaq T C 12: 21,446,389 (GRCm39) E159G possibly damaging Het
Zdhhc12 A G 2: 29,983,521 (GRCm39) V27A probably damaging Het
Other mutations in Cpt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cpt1b APN 15 89,305,066 (GRCm39) missense probably benign 0.01
IGL00497:Cpt1b APN 15 89,306,496 (GRCm39) missense probably benign 0.22
IGL01142:Cpt1b APN 15 89,303,196 (GRCm39) missense probably benign
IGL02329:Cpt1b APN 15 89,307,942 (GRCm39) missense probably benign
IGL02740:Cpt1b APN 15 89,308,535 (GRCm39) missense probably damaging 1.00
IGL03196:Cpt1b APN 15 89,308,598 (GRCm39) missense probably benign
macellaio UTSW 15 89,307,857 (GRCm39) critical splice donor site probably null
oleagenous UTSW 15 89,309,417 (GRCm39) missense probably damaging 1.00
IGL02796:Cpt1b UTSW 15 89,309,005 (GRCm39) missense probably benign 0.04
PIT4519001:Cpt1b UTSW 15 89,303,066 (GRCm39) missense probably damaging 1.00
R0276:Cpt1b UTSW 15 89,304,162 (GRCm39) missense probably benign 0.12
R0302:Cpt1b UTSW 15 89,302,073 (GRCm39) missense probably benign
R0454:Cpt1b UTSW 15 89,308,596 (GRCm39) missense possibly damaging 0.47
R1199:Cpt1b UTSW 15 89,303,213 (GRCm39) missense probably benign 0.01
R1633:Cpt1b UTSW 15 89,303,018 (GRCm39) missense probably damaging 0.98
R1674:Cpt1b UTSW 15 89,306,535 (GRCm39) missense possibly damaging 0.64
R2087:Cpt1b UTSW 15 89,306,411 (GRCm39) missense probably benign 0.07
R2178:Cpt1b UTSW 15 89,303,246 (GRCm39) missense probably damaging 1.00
R2414:Cpt1b UTSW 15 89,304,283 (GRCm39) splice site probably benign
R2507:Cpt1b UTSW 15 89,303,301 (GRCm39) missense probably benign 0.08
R2883:Cpt1b UTSW 15 89,302,072 (GRCm39) missense probably benign 0.00
R3432:Cpt1b UTSW 15 89,307,944 (GRCm39) missense possibly damaging 0.85
R3783:Cpt1b UTSW 15 89,309,392 (GRCm39) missense probably damaging 1.00
R4574:Cpt1b UTSW 15 89,308,247 (GRCm39) splice site probably null
R4737:Cpt1b UTSW 15 89,305,609 (GRCm39) missense probably benign 0.03
R5122:Cpt1b UTSW 15 89,308,226 (GRCm39) missense probably benign 0.09
R5320:Cpt1b UTSW 15 89,303,477 (GRCm39) missense probably benign 0.00
R5699:Cpt1b UTSW 15 89,308,476 (GRCm39) missense probably benign 0.44
R5710:Cpt1b UTSW 15 89,309,409 (GRCm39) missense probably damaging 1.00
R5873:Cpt1b UTSW 15 89,304,931 (GRCm39) missense probably damaging 1.00
R5941:Cpt1b UTSW 15 89,309,417 (GRCm39) missense probably damaging 1.00
R6163:Cpt1b UTSW 15 89,308,620 (GRCm39) missense probably benign 0.15
R6197:Cpt1b UTSW 15 89,309,037 (GRCm39) missense possibly damaging 0.77
R6323:Cpt1b UTSW 15 89,303,266 (GRCm39) missense probably benign 0.10
R6486:Cpt1b UTSW 15 89,305,027 (GRCm39) missense probably benign
R7571:Cpt1b UTSW 15 89,305,546 (GRCm39) critical splice donor site probably null
R7648:Cpt1b UTSW 15 89,305,570 (GRCm39) missense probably damaging 1.00
R7743:Cpt1b UTSW 15 89,305,607 (GRCm39) missense probably benign 0.25
R7893:Cpt1b UTSW 15 89,307,857 (GRCm39) critical splice donor site probably null
R8021:Cpt1b UTSW 15 89,305,629 (GRCm39) missense probably benign 0.00
R8207:Cpt1b UTSW 15 89,303,018 (GRCm39) missense probably damaging 0.98
R8394:Cpt1b UTSW 15 89,306,490 (GRCm39) critical splice donor site probably null
R8552:Cpt1b UTSW 15 89,306,524 (GRCm39) missense probably damaging 1.00
R8732:Cpt1b UTSW 15 89,308,628 (GRCm39) missense probably benign
R9564:Cpt1b UTSW 15 89,303,472 (GRCm39) missense probably damaging 1.00
R9643:Cpt1b UTSW 15 89,303,229 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TAGCCTGTATACCTGCTCGG -3'
(R):5'- TGGATCATGAGTGTTAGCCGTATAG -3'

Sequencing Primer
(F):5'- GTATACCTGCTCGGGAATGTCC -3'
(R):5'- CCGTATAGGGGTAGGGCAGC -3'
Posted On 2016-08-04