Incidental Mutation 'R5365:Pla1a'
ID423101
Institutional Source Beutler Lab
Gene Symbol Pla1a
Ensembl Gene ENSMUSG00000002847
Gene Namephospholipase A1 member A
SynonymsPs-pla1
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location38396117-38433145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38417207 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 43 (L43P)
Ref Sequence ENSEMBL: ENSMUSP00000002926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002926]
Predicted Effect probably benign
Transcript: ENSMUST00000002926
AA Change: L43P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000002926
Gene: ENSMUSG00000002847
AA Change: L43P

DomainStartEndE-ValueType
Pfam:Lipase 15 336 9.4e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232224
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phospholipase that hydrolyzes fatty acids at the sn-1 position of phosphatidylserine and 1-acyl-2-lysophosphatidylserine. This secreted protein hydrolyzes phosphatidylserine in liposomes. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Pla1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pla1a APN 16 38414850 missense probably damaging 1.00
IGL01086:Pla1a APN 16 38407622 missense probably benign 0.02
IGL01126:Pla1a APN 16 38407639 missense probably benign
R1674:Pla1a UTSW 16 38414810 missense probably benign 0.00
R2101:Pla1a UTSW 16 38415368 missense probably damaging 0.99
R2415:Pla1a UTSW 16 38407750 missense possibly damaging 0.69
R2987:Pla1a UTSW 16 38407742 missense probably damaging 1.00
R4492:Pla1a UTSW 16 38409610 missense probably benign
R5424:Pla1a UTSW 16 38414775 missense probably damaging 1.00
R6349:Pla1a UTSW 16 38417124 missense probably benign 0.04
R6388:Pla1a UTSW 16 38397472 missense probably benign
R6443:Pla1a UTSW 16 38409587 splice site probably null
R6996:Pla1a UTSW 16 38397468 missense probably benign 0.04
R7021:Pla1a UTSW 16 38400882 missense probably damaging 0.97
R7519:Pla1a UTSW 16 38414846 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCCTACGGGTTGCTTAGCTC -3'
(R):5'- TCGGCTTACAGAACTGATGCAAC -3'

Sequencing Primer
(F):5'- GGGTTGCTTAGCTCTCACCTG -3'
(R):5'- ATTAATCGCTGAGCTGGCTGAC -3'
Posted On2016-08-04