Incidental Mutation 'R5365:Nectin3'
ID423102
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Namenectin cell adhesion molecule 3
Synonyms3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location46387706-46498525 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 46464106 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 71 (K71*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]
Predicted Effect probably null
Transcript: ENSMUST00000023334
AA Change: K72*
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: K72*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023335
AA Change: K72*
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: K72*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000096052
AA Change: K72*
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: K72*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133935
Predicted Effect probably null
Transcript: ENSMUST00000149901
AA Change: K71*
SMART Domains Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656
AA Change: K71*

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:Ig_3 184 243 4.8e-5 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46458853 missense probably benign 0.23
R0373:Nectin3 UTSW 16 46458187 missense probably damaging 0.99
R0550:Nectin3 UTSW 16 46458820 missense possibly damaging 0.86
R1219:Nectin3 UTSW 16 46454679 nonsense probably null
R1251:Nectin3 UTSW 16 46463842 missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46448756 missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46448394 nonsense probably null
R2250:Nectin3 UTSW 16 46454736 missense probably benign 0.00
R2448:Nectin3 UTSW 16 46448515 unclassified probably null
R2483:Nectin3 UTSW 16 46395179 missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46448590 missense probably benign 0.15
R4709:Nectin3 UTSW 16 46463943 missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46448160 intron probably benign
R4884:Nectin3 UTSW 16 46448886 missense probably benign 0.01
R5051:Nectin3 UTSW 16 46448550 missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46448449 missense probably benign 0.03
R5272:Nectin3 UTSW 16 46448476 missense possibly damaging 0.82
R5768:Nectin3 UTSW 16 46458817 missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46464145 missense probably benign 0.00
R6029:Nectin3 UTSW 16 46436400 missense probably benign 0.08
R6131:Nectin3 UTSW 16 46395152 missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46395150 missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46463982 missense probably damaging 0.98
R6347:Nectin3 UTSW 16 46458124 missense probably benign 0.01
R6360:Nectin3 UTSW 16 46411109 missense probably benign 0.09
R6505:Nectin3 UTSW 16 46448821 missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46463842 missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46395143 missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46395121 missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46448396 missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46496742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGAAGCCTATGTTATGCAGAG -3'
(R):5'- CCCATCTCATCTGTTCAGAGAGG -3'

Sequencing Primer
(F):5'- CCTATGTTATGCAGAGTAATTGTTGC -3'
(R):5'- ATCTCATCTGTTCAGAGAGGTGTGTG -3'
Posted On2016-08-04