Incidental Mutation 'R5365:Ephx3'
ID423103
Institutional Source Beutler Lab
Gene Symbol Ephx3
Ensembl Gene ENSMUSG00000037577
Gene Nameepoxide hydrolase 3
Synonyms2310063B19Rik, Abhd9
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5365 (G1)
Quality Score219
Status Not validated
Chromosome17
Chromosomal Location32183770-32189549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32189249 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 67 (L67P)
Ref Sequence ENSEMBL: ENSMUSP00000124600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087721] [ENSMUST00000162117]
Predicted Effect probably damaging
Transcript: ENSMUST00000087721
AA Change: L67P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085013
Gene: ENSMUSG00000037577
AA Change: L67P

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
Pfam:Abhydrolase_1 162 276 1.4e-16 PFAM
Pfam:Abhydrolase_5 163 402 9.1e-12 PFAM
Pfam:Abhydrolase_6 164 413 7.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162117
AA Change: L67P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124600
Gene: ENSMUSG00000037577
AA Change: L67P

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
Pfam:Abhydrolase_5 156 395 6e-12 PFAM
Pfam:Abhydrolase_6 157 406 4.2e-36 PFAM
Pfam:Abhydrolase_1 181 410 7.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Ephx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Ephx3 APN 17 32188245 missense probably damaging 1.00
R1142:Ephx3 UTSW 17 32185274 missense probably benign 0.00
R2175:Ephx3 UTSW 17 32188459 missense possibly damaging 0.74
R6971:Ephx3 UTSW 17 32188203 missense possibly damaging 0.92
R7114:Ephx3 UTSW 17 32185032 missense possibly damaging 0.75
R7236:Ephx3 UTSW 17 32185354 critical splice acceptor site probably null
R7532:Ephx3 UTSW 17 32188789 missense possibly damaging 0.77
X0062:Ephx3 UTSW 17 32189387 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAAAGCAATGCTCGCCCAG -3'
(R):5'- GAGAGGTGGCAGTATCTGTC -3'

Sequencing Primer
(F):5'- TGGGGTCTCTCAGGCACTC -3'
(R):5'- TGGCAGTATCTGTCCGAGC -3'
Posted On2016-08-04