Incidental Mutation 'R5365:Pigf'
ID423105
Institutional Source Beutler Lab
Gene Symbol Pigf
Ensembl Gene ENSMUSG00000024145
Gene Namephosphatidylinositol glycan anchor biosynthesis, class F
Synonyms
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location86997256-87025406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87023708 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 62 (V62E)
Ref Sequence ENSEMBL: ENSMUSP00000024957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024957] [ENSMUST00000024959] [ENSMUST00000160269]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024957
AA Change: V62E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024957
Gene: ENSMUSG00000024145
AA Change: V62E

DomainStartEndE-ValueType
Pfam:PIG-F 21 204 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024959
SMART Domains Protein: ENSMUSP00000024959
Gene: ENSMUSG00000024146

DomainStartEndE-ValueType
Pfam:Cript 11 101 2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160269
SMART Domains Protein: ENSMUSP00000124994
Gene: ENSMUSG00000024146

DomainStartEndE-ValueType
Pfam:Cript 20 109 2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160824
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor, a glycolipid containing three mannose molecules in its core backbone, is found on many blood cells where it serves to anchor proteins to the cell surface. The encoded protein and another GPI synthesis protein, PIGO, function in the transfer of ethanolaminephosphate to the third mannose in GPI. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Pigf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pigf APN 17 87020448 missense probably null 0.41
IGL01484:Pigf APN 17 87008880 missense probably benign 0.04
R0506:Pigf UTSW 17 87008909 missense probably benign 0.00
R0684:Pigf UTSW 17 87020495 missense probably benign 0.31
R0987:Pigf UTSW 17 86997545 missense probably damaging 1.00
R4295:Pigf UTSW 17 87023756 missense probably benign 0.00
R6287:Pigf UTSW 17 86997539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTGAAGGAGTCATAATTCCAC -3'
(R):5'- CTGACATCAAGAGACTTCTGTATACC -3'

Sequencing Primer
(F):5'- GGAGTCATAATTCCACAATGAATGC -3'
(R):5'- TCTGTATACCAATCTTTTGTGCG -3'
Posted On2016-08-04