Incidental Mutation 'R5365:Hnrnpul2'
ID423106
Institutional Source Beutler Lab
Gene Symbol Hnrnpul2
Ensembl Gene ENSMUSG00000071659
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 2
Synonyms1110031M08Rik, Hnrpul2
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R5365 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8819401-8834142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8820716 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 145 (H145Q)
Ref Sequence ENSEMBL: ENSMUSP00000094515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088092] [ENSMUST00000096751] [ENSMUST00000096753] [ENSMUST00000153281]
Predicted Effect probably benign
Transcript: ENSMUST00000088092
SMART Domains Protein: ENSMUSP00000085413
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096751
SMART Domains Protein: ENSMUSP00000094513
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096753
AA Change: H145Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659
AA Change: H145Q

DomainStartEndE-ValueType
SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148090
Predicted Effect probably benign
Transcript: ENSMUST00000153281
SMART Domains Protein: ENSMUSP00000120656
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
Pfam:TPR_11 6 93 1e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mbtps2 G A X: 157,568,299 T157M possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Hnrnpul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpul2 APN 19 8823628 missense probably damaging 1.00
R0136:Hnrnpul2 UTSW 19 8826801 missense probably damaging 1.00
R0369:Hnrnpul2 UTSW 19 8824413 missense probably damaging 1.00
R0781:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R0784:Hnrnpul2 UTSW 19 8825052 missense possibly damaging 0.82
R1110:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R1227:Hnrnpul2 UTSW 19 8823237 missense possibly damaging 0.91
R1589:Hnrnpul2 UTSW 19 8831332 missense probably benign 0.00
R2126:Hnrnpul2 UTSW 19 8824438 nonsense probably null
R2226:Hnrnpul2 UTSW 19 8824985 missense probably damaging 0.96
R2243:Hnrnpul2 UTSW 19 8820637 missense probably benign
R3703:Hnrnpul2 UTSW 19 8824409 missense probably damaging 1.00
R4038:Hnrnpul2 UTSW 19 8823227 unclassified probably benign
R4856:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R4886:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R5016:Hnrnpul2 UTSW 19 8822825 missense possibly damaging 0.94
R5435:Hnrnpul2 UTSW 19 8820318 missense probably benign 0.32
R5951:Hnrnpul2 UTSW 19 8824891 missense probably damaging 1.00
R6181:Hnrnpul2 UTSW 19 8823232 missense possibly damaging 0.70
R6824:Hnrnpul2 UTSW 19 8826717 missense possibly damaging 0.89
R6924:Hnrnpul2 UTSW 19 8831509 missense unknown
R6978:Hnrnpul2 UTSW 19 8824276 missense probably damaging 1.00
R7602:Hnrnpul2 UTSW 19 8831309 missense probably damaging 0.99
R7688:Hnrnpul2 UTSW 19 8820630 missense probably benign
R7726:Hnrnpul2 UTSW 19 8831280 missense possibly damaging 0.61
R7749:Hnrnpul2 UTSW 19 8820424 missense probably benign
R7753:Hnrnpul2 UTSW 19 8824972 missense probably damaging 1.00
R8007:Hnrnpul2 UTSW 19 8820815 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- ACTGGATGCTGAGATGCTG -3'
(R):5'- ACTTTCGGGCAAGTGGAAAC -3'

Sequencing Primer
(F):5'- TGCTGAGATGCTGGAGGAC -3'
(R):5'- ATCAGATAGCGCGGTGC -3'
Posted On2016-08-04