Incidental Mutation 'R5365:Mbtps2'
ID423107
Institutional Source Beutler Lab
Gene Symbol Mbtps2
Ensembl Gene ENSMUSG00000046873
Gene Namemembrane-bound transcription factor peptidase, site 2
Synonyms9630032G22Rik
MMRRC Submission 042943-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5365 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location157535371-157598715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 157568299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 157 (T157M)
Ref Sequence ENSEMBL: ENSMUSP00000137233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058098] [ENSMUST00000065806] [ENSMUST00000112522] [ENSMUST00000149249] [ENSMUST00000179062]
Predicted Effect probably benign
Transcript: ENSMUST00000058098
SMART Domains Protein: ENSMUSP00000059471
Gene: ENSMUSG00000046873

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
Pfam:Peptidase_M50 155 514 4.3e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065806
AA Change: T157M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070112
Gene: ENSMUSG00000091736
AA Change: T157M

DomainStartEndE-ValueType
ZnF_C2H2 260 284 1.79e-2 SMART
ZnF_C2H2 289 311 2.2e-2 SMART
ZnF_C2H2 317 341 8.47e-4 SMART
ZnF_C2H2 347 371 3.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065857
Predicted Effect probably benign
Transcript: ENSMUST00000112522
SMART Domains Protein: ENSMUSP00000108141
Gene: ENSMUSG00000046873

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
Pfam:Peptidase_M50 155 214 4.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139786
Predicted Effect probably benign
Transcript: ENSMUST00000149249
SMART Domains Protein: ENSMUSP00000118134
Gene: ENSMUSG00000046873

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
Pfam:Peptidase_M50 76 110 2.9e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179062
AA Change: T157M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137233
Gene: ENSMUSG00000046873
AA Change: T157M

DomainStartEndE-ValueType
ZnF_C2H2 260 284 1.79e-2 SMART
ZnF_C2H2 289 311 2.2e-2 SMART
ZnF_C2H2 317 341 8.47e-4 SMART
ZnF_C2H2 347 371 3.39e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a intramembrane zinc metalloprotease, which is essential in development. This protease functions in the signal protein activation involved in sterol control of transcription and the ER stress response. Mutations in this gene have been associated with ichthyosis follicularis with atrichia and photophobia (IFAP syndrome); IFAP syndrome has been quantitatively linked to a reduction in cholesterol homeostasis and ER stress response.[provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,628,629 E4877G probably damaging Het
Acss3 C T 10: 107,004,728 A391T probably damaging Het
Bcan T C 3: 87,989,235 Y718C probably damaging Het
Bnc2 T C 4: 84,411,429 probably benign Het
Card6 A G 15: 5,105,406 V105A possibly damaging Het
Ceacam5 A G 7: 17,759,548 Y832C probably damaging Het
Ces2e T C 8: 104,927,214 probably null Het
Cpt1b A T 15: 89,420,107 I480N possibly damaging Het
Csmd3 T C 15: 48,004,749 T792A possibly damaging Het
Ctsq T A 13: 61,037,818 I170F possibly damaging Het
Cyfip2 A G 11: 46,247,630 S772P probably damaging Het
Cyp3a16 A C 5: 145,452,787 M256R probably damaging Het
Dgkd C T 1: 87,935,416 R62C probably damaging Het
Ephx3 A G 17: 32,189,249 L67P probably damaging Het
Gpc2 A G 5: 138,275,623 Y438H probably damaging Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Igkv9-120 T C 6: 68,050,449 S116P probably benign Het
Impad1 G A 4: 4,776,385 T190I probably damaging Het
Itgal A G 7: 127,305,350 I332V probably damaging Het
Lrit1 A G 14: 37,062,142 T476A probably benign Het
Lrp1b T C 2: 40,647,125 H50R possibly damaging Het
March7 T C 2: 60,233,914 V178A possibly damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mill2 T C 7: 18,858,414 V320A probably benign Het
Mtor G A 4: 148,550,130 V2403M probably damaging Het
Nectin3 T A 16: 46,464,106 K71* probably null Het
Olfr117 T A 17: 37,659,695 I213F probably damaging Het
Otof T C 5: 30,381,800 Y1090C probably damaging Het
Pigf A T 17: 87,023,708 V62E possibly damaging Het
Pla1a A G 16: 38,417,207 L43P probably benign Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sbno1 TCCC TCC 5: 124,381,866 probably null Het
Tgm4 A C 9: 123,066,801 K223N probably damaging Het
Ttn G T 2: 76,914,646 A5353E probably damaging Het
Ywhaq T C 12: 21,396,388 E159G possibly damaging Het
Zdhhc12 A G 2: 30,093,509 V27A probably damaging Het
Other mutations in Mbtps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mbtps2 UTSW X 157568368 missense probably benign 0.01
R2251:Mbtps2 UTSW X 157559033 missense probably benign 0.03
R2253:Mbtps2 UTSW X 157559033 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATCAATGCCAGGTATTCCTTCAG -3'
(R):5'- TGGGCTACCAAGACTCAGAC -3'

Sequencing Primer
(F):5'- TGTCATATACTCAGAATAATCGGGGG -3'
(R):5'- TCAGACAACCTACTATTCAGTCCTG -3'
Posted On2016-08-04