Mutagenetix > Incidental Mutation

Incidental Mutation 'R5330:Sel1l3'

423129

Institutional Source

Beutler Lab

Gene Symbol

Sel1l3

Ensembl Gene

ENSMUSG00000029189

Gene Name

sel-1 suppressor of lin-12-like 3 (C. elegans)

Synonyms

2310045A20Rik

MMRRC Submission

042912-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5330 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53107083-53213927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53186009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 314 (Y314N)

Ref Sequence

ENSEMBL: ENSMUSP00000031090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031090]

AlphaFold

Q80TS8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031090
AA Change: Y314N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: Y314N

Domain	Start	End	E-Value	Type
low complexity region	11	33	N/A	INTRINSIC
SEL1	575	609	3.39e1	SMART
SEL1	611	647	1.85e1	SMART
SEL1	694	730	5.27e-5	SMART
SEL1	732	767	2.94e-3	SMART
SEL1	768	800	5.32e-1	SMART
SEL1	801	839	1.23e-5	SMART
SEL1	840	877	8.55e1	SMART
SEL1	952	988	2.56e-3	SMART
low complexity region	1048	1058	N/A	INTRINSIC
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1102	1127	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196435

Meta Mutation Damage Score

0.5256

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

99% (95/96)

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,091,858		probably benign	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
A2m	A	G	6: 121,638,416	D83G	probably benign	Het
Abca16	T	A	7: 120,503,377	I833N	probably benign	Het
Adam6b	C	A	12: 113,490,580	P339H	possibly damaging	Het
Adgrb2	A	T	4: 130,022,202	H1505L	possibly damaging	Het
Aktip	A	T	8: 91,126,724	F122I	probably damaging	Het
Ankrd27	T	A	7: 35,615,926	L500*	probably null	Het
Blm	T	C	7: 80,458,936	E55G	possibly damaging	Het
Carmil1	A	T	13: 24,025,946		probably null	Het
Cdca7	T	C	2: 72,484,698	C311R	probably damaging	Het
Cds1	T	C	5: 101,798,495	S187P	probably damaging	Het
Chuk	A	T	19: 44,078,955	V587E	probably damaging	Het
Commd10	T	C	18: 46,960,430	V19A	probably damaging	Het
Ctnnd2	C	T	15: 30,332,115	T48I	probably damaging	Het
Cyp2b10	T	A	7: 25,913,989	Y203*	probably null	Het
Dchs1	A	T	7: 105,754,602	V2911E	probably damaging	Het
Dnah12	G	A	14: 26,773,830	E1472K	probably damaging	Het
Dnah3	T	C	7: 119,943,648	T3514A	probably benign	Het
Dnah6	T	A	6: 73,074,590	I3074F	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fam131c	A	T	4: 141,382,830	T180S	probably benign	Het
Fbxo41	T	C	6: 85,479,906	E427G	probably benign	Het
Gabrr2	A	G	4: 33,082,583	K236E	possibly damaging	Het
Gm10152	A	T	7: 144,763,546		noncoding transcript	Het
Gm10313	T	A	8: 46,255,453		noncoding transcript	Het
Gm5414	C	A	15: 101,624,664	V443F	probably damaging	Het
Gm7334	T	C	17: 50,699,132	S149P	possibly damaging	Het
Grik2	G	A	10: 49,132,771	T740M	probably damaging	Het
Hdac5	T	C	11: 102,197,354	Y930C	probably damaging	Het
Hepacam2	T	C	6: 3,483,377	T211A	probably benign	Het
Herc4	G	T	10: 63,307,799	E703*	probably null	Het
Hivep2	A	G	10: 14,131,420	K1254R	probably damaging	Het
Hras	T	C	7: 141,192,940	M1V	probably null	Het
Ikbkap	T	C	4: 56,800,001	T42A	probably benign	Het
Il23r	T	G	6: 67,423,495	Q617P	probably damaging	Het
Kank1	A	G	19: 25,411,329	T789A	probably damaging	Het
Kcnj12	A	G	11: 61,070,186	K437E	probably benign	Het
Lct	A	T	1: 128,298,529	D1374E	probably benign	Het
Luc7l	C	A	17: 26,275,733	C104*	probably null	Het
Lurap1	G	A	4: 116,144,404	L31F	probably damaging	Het
Mark4	G	A	7: 19,436,983	P321S	probably damaging	Het
Med18	A	G	4: 132,463,066		probably benign	Het
Mia2	A	G	12: 59,095,812	S5G	probably benign	Het
Mrgprb3	T	C	7: 48,642,934	T290A	possibly damaging	Het
Negr1	A	T	3: 157,069,276	K210*	probably null	Het
Nktr	T	C	9: 121,752,768		probably benign	Het
Nob1	T	G	8: 107,416,249	T267P	probably damaging	Het
Nos3	A	G	5: 24,369,904	E307G	probably damaging	Het
Nrxn2	A	G	19: 6,490,081	T796A	probably damaging	Het
Nwd2	C	A	5: 63,806,516	L1148I	probably benign	Het
Pcdh17	T	A	14: 84,533,046	V988E	probably damaging	Het
Pcdha4	G	A	18: 36,954,702	R646H	probably benign	Het
Per3	G	T	4: 151,041,302	L187I	probably damaging	Het
Phlpp2	A	G	8: 109,934,035	D774G	probably damaging	Het
Pibf1	T	C	14: 99,140,646	Y403H	probably damaging	Het
Plcl2	G	A	17: 50,509,848	A81T	probably benign	Het
Polr2a	T	C	11: 69,747,275	N123D	probably benign	Het
Psma5	T	G	3: 108,268,070	V146G	possibly damaging	Het
Ptprk	A	T	10: 28,587,080	D189V	probably damaging	Het
Relb	C	T	7: 19,606,705	G509S	possibly damaging	Het
Rgs11	A	T	17: 26,202,973	M1L	probably benign	Het
Rhbg	T	A	3: 88,245,468	T313S	probably benign	Het
Ripply2	T	A	9: 87,015,638		probably benign	Het
Scap	T	C	9: 110,381,633	V1011A	probably benign	Het
Scarf1	G	A	11: 75,515,580	G230D	probably damaging	Het
Slc17a8	A	G	10: 89,589,494		probably null	Het
Slc22a14	A	T	9: 119,230,596	L153Q	probably damaging	Het
Slc22a27	A	G	19: 7,879,455	I406T	probably benign	Het
Slc30a6	A	G	17: 74,423,195	D355G	probably benign	Het
Snta1	C	A	2: 154,378,020	E403*	probably null	Het
Socs7	A	G	11: 97,378,026	D382G	possibly damaging	Het
Spata31d1a	A	T	13: 59,700,403	C1304S	possibly damaging	Het
Srebf2	T	A	15: 82,196,208	I834N	possibly damaging	Het
Steap1	G	T	5: 5,740,422	H175Q	probably damaging	Het
Sult2a8	T	C	7: 14,413,754	E204G	possibly damaging	Het
Tacc2	T	C	7: 130,733,528	S524P	probably damaging	Het
Tbc1d9b	C	T	11: 50,146,313	A263V	probably benign	Het
Tecta	A	C	9: 42,337,856	D1903E	probably damaging	Het
Tmem222	A	C	4: 133,277,624	M34R	possibly damaging	Het
Tnik	A	G	3: 28,542,018	T187A	probably damaging	Het
Trpv4	A	G	5: 114,635,543	Y253H	probably damaging	Het
Trpv5	G	A	6: 41,660,332	R358C	probably benign	Het
Ttll13	T	C	7: 80,260,509	V800A	probably benign	Het
Ush2a	G	A	1: 188,728,381	G2613E	probably benign	Het
Vmn2r58	G	A	7: 41,863,960	Q420*	probably null	Het
Zranb3	G	A	1: 127,959,720	P990L	probably damaging	Het
Zswim9	T	A	7: 13,259,985	D748V	probably damaging	Het

Other mutations in Sel1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Sel1l3	APN	5	53116333	missense	probably damaging	0.96
IGL01585:Sel1l3	APN	5	53154236	missense	probably damaging	0.99
IGL01717:Sel1l3	APN	5	53200168	missense	probably damaging	0.99
IGL01771:Sel1l3	APN	5	53121841	missense	probably damaging	0.99
IGL01926:Sel1l3	APN	5	53200143	missense	probably benign	0.26
IGL01963:Sel1l3	APN	5	53200338	missense	probably damaging	0.99
IGL02000:Sel1l3	APN	5	53145493	missense	probably damaging	1.00
IGL02132:Sel1l3	APN	5	53170405	missense	possibly damaging	0.89
IGL02198:Sel1l3	APN	5	53139799	splice site	probably benign
IGL02930:Sel1l3	APN	5	53123217	missense	possibly damaging	0.65
IGL03146:Sel1l3	APN	5	53154243	missense	probably benign	0.00
IGL03175:Sel1l3	APN	5	53121857	missense	probably damaging	1.00
R0083:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0940:Sel1l3	UTSW	5	53144037	splice site	probably benign
R1027:Sel1l3	UTSW	5	53145478	missense	possibly damaging	0.68
R1117:Sel1l3	UTSW	5	53172607	missense	probably benign	0.00
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1345:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1370:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1503:Sel1l3	UTSW	5	53137929	missense	probably damaging	0.98
R1747:Sel1l3	UTSW	5	53145545	missense	possibly damaging	0.91
R1764:Sel1l3	UTSW	5	53170447	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R3434:Sel1l3	UTSW	5	53117090	missense	probably benign	0.44
R4043:Sel1l3	UTSW	5	53188054	nonsense	probably null
R4074:Sel1l3	UTSW	5	53154287	missense	probably damaging	0.99
R4727:Sel1l3	UTSW	5	53144183	critical splice acceptor site	probably null
R4788:Sel1l3	UTSW	5	53131833	missense	probably benign	0.41
R4900:Sel1l3	UTSW	5	53131842	missense	probably damaging	1.00
R5000:Sel1l3	UTSW	5	53200434	missense	probably damaging	0.97
R5090:Sel1l3	UTSW	5	53200046	missense	probably benign	0.03
R5456:Sel1l3	UTSW	5	53200036	missense	probably benign	0.13
R5544:Sel1l3	UTSW	5	53200302	missense	probably damaging	0.98
R5848:Sel1l3	UTSW	5	53184808	missense	possibly damaging	0.91
R6132:Sel1l3	UTSW	5	53200189	missense	possibly damaging	0.77
R6188:Sel1l3	UTSW	5	53155719	missense	possibly damaging	0.70
R6622:Sel1l3	UTSW	5	53139860	missense	probably damaging	0.98
R7015:Sel1l3	UTSW	5	53172574	missense	probably benign	0.03
R7200:Sel1l3	UTSW	5	53144109	missense	probably benign	0.22
R7271:Sel1l3	UTSW	5	53116362	missense	probably damaging	0.98
R7378:Sel1l3	UTSW	5	53116409	missense	probably benign	0.02
R7479:Sel1l3	UTSW	5	53117120	missense	probably damaging	0.99
R7563:Sel1l3	UTSW	5	53185984	missense	probably damaging	1.00
R7643:Sel1l3	UTSW	5	53123162	splice site	probably null
R7741:Sel1l3	UTSW	5	53200251	missense	probably damaging	1.00
R7743:Sel1l3	UTSW	5	53135885	missense	probably benign	0.07
R7861:Sel1l3	UTSW	5	53144064	missense	probably damaging	0.96
R7904:Sel1l3	UTSW	5	53139824	missense	probably benign	0.24
R8222:Sel1l3	UTSW	5	53187954	critical splice donor site	probably null
R8724:Sel1l3	UTSW	5	53135823	nonsense	probably null
R8788:Sel1l3	UTSW	5	53174806	nonsense	probably null
R8988:Sel1l3	UTSW	5	53123429	missense	probably damaging	0.96
R9111:Sel1l3	UTSW	5	53121871	splice site	probably benign
R9153:Sel1l3	UTSW	5	53135846	missense	probably benign	0.26
R9269:Sel1l3	UTSW	5	53154286	missense	probably damaging	1.00
R9399:Sel1l3	UTSW	5	53108144	missense	probably benign
R9455:Sel1l3	UTSW	5	53131815	missense	probably damaging	0.99
R9630:Sel1l3	UTSW	5	53184775	missense	possibly damaging	0.49
R9793:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
R9795:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
Z1088:Sel1l3	UTSW	5	53116196	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTTAACCTCCTAGCGCCACG -3'
(R):5'- TGTCTCAAAATCTCAGGCTTTGC -3'

Sequencing Primer
(F):5'- GCCACGGCACTGACAATATCTTC -3'
(R):5'- TGATCTCCCCTGATGAACACTAAGG -3'

Posted On

2016-08-04