Incidental Mutation 'R5330:Mark4'
ID423141
Institutional Source Beutler Lab
Gene Symbol Mark4
Ensembl Gene ENSMUSG00000030397
Gene NameMAP/microtubule affinity regulating kinase 4
SynonymsMarkl1, 2410090P21Rik
MMRRC Submission 042912-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5330 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19424775-19458821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19436983 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 321 (P321S)
Ref Sequence ENSEMBL: ENSMUSP00000082862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085715] [ENSMUST00000209058]
Predicted Effect probably damaging
Transcript: ENSMUST00000085715
AA Change: P321S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397
AA Change: P321S

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207767
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Meta Mutation Damage Score 0.3985 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit insulin hypersensitivity and resistance to diet-induced obersity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,638,416 D83G probably benign Het
Abca16 T A 7: 120,503,377 I833N probably benign Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Aktip A T 8: 91,126,724 F122I probably damaging Het
Ankrd27 T A 7: 35,615,926 L500* probably null Het
Blm T C 7: 80,458,936 E55G possibly damaging Het
Carmil1 A T 13: 24,025,946 probably null Het
Cdca7 T C 2: 72,484,698 C311R probably damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctnnd2 C T 15: 30,332,115 T48I probably damaging Het
Cyp2b10 T A 7: 25,913,989 Y203* probably null Het
Dchs1 A T 7: 105,754,602 V2911E probably damaging Het
Dnah12 G A 14: 26,773,830 E1472K probably damaging Het
Dnah3 T C 7: 119,943,648 T3514A probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm10313 T A 8: 46,255,453 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hivep2 A G 10: 14,131,420 K1254R probably damaging Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Lct A T 1: 128,298,529 D1374E probably benign Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Med18 A G 4: 132,463,066 probably benign Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nob1 T G 8: 107,416,249 T267P probably damaging Het
Nos3 A G 5: 24,369,904 E307G probably damaging Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Pcdh17 T A 14: 84,533,046 V988E probably damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Phlpp2 A G 8: 109,934,035 D774G probably damaging Het
Pibf1 T C 14: 99,140,646 Y403H probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Ptprk A T 10: 28,587,080 D189V probably damaging Het
Relb C T 7: 19,606,705 G509S possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Sel1l3 A T 5: 53,186,009 Y314N possibly damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Snta1 C A 2: 154,378,020 E403* probably null Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Spata31d1a A T 13: 59,700,403 C1304S possibly damaging Het
Srebf2 T A 15: 82,196,208 I834N possibly damaging Het
Steap1 G T 5: 5,740,422 H175Q probably damaging Het
Sult2a8 T C 7: 14,413,754 E204G possibly damaging Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tecta A C 9: 42,337,856 D1903E probably damaging Het
Tmem222 A C 4: 133,277,624 M34R possibly damaging Het
Tnik A G 3: 28,542,018 T187A probably damaging Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ttll13 T C 7: 80,260,509 V800A probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Vmn2r58 G A 7: 41,863,960 Q420* probably null Het
Zranb3 G A 1: 127,959,720 P990L probably damaging Het
Zswim9 T A 7: 13,259,985 D748V probably damaging Het
Other mutations in Mark4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mark4 APN 7 19431824 missense possibly damaging 0.50
IGL02321:Mark4 APN 7 19426389 missense probably benign
IGL02813:Mark4 APN 7 19447256 splice site probably null
IGL03088:Mark4 APN 7 19451584 missense probably damaging 1.00
R0555:Mark4 UTSW 7 19448673 splice site probably benign
R1278:Mark4 UTSW 7 19431770 missense probably damaging 0.99
R1385:Mark4 UTSW 7 19426027 unclassified probably null
R3415:Mark4 UTSW 7 19451725 missense probably benign 0.00
R3828:Mark4 UTSW 7 19443187 missense possibly damaging 0.65
R4281:Mark4 UTSW 7 19433446 missense probably benign 0.09
R4682:Mark4 UTSW 7 19445172 splice site probably null
R4791:Mark4 UTSW 7 19451657 missense probably benign 0.19
R5184:Mark4 UTSW 7 19447243 missense possibly damaging 0.95
R5319:Mark4 UTSW 7 19436961 missense possibly damaging 0.95
R5488:Mark4 UTSW 7 19429607 splice site probably null
R5811:Mark4 UTSW 7 19448639 missense probably damaging 1.00
R6058:Mark4 UTSW 7 19426385 missense probably benign 0.10
R6148:Mark4 UTSW 7 19429516 missense probably benign 0.00
R6333:Mark4 UTSW 7 19443283 missense probably damaging 0.98
R6698:Mark4 UTSW 7 19429437 missense probably benign 0.01
R7265:Mark4 UTSW 7 19451725 missense probably benign 0.00
R7429:Mark4 UTSW 7 19426167 missense probably damaging 0.99
R7664:Mark4 UTSW 7 19443226 missense probably damaging 1.00
R8027:Mark4 UTSW 7 19447239 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGGTGCTGGGAGAGACATTC -3'
(R):5'- AGCTCTTAGGATGATTACAGGGTG -3'

Sequencing Primer
(F):5'- TGCTGGGAGAGACATTCCTCAAC -3'
(R):5'- ATTACAGGGTGCTGGGGAC -3'
Posted On2016-08-04