Mutagenetix > Incidental Mutation

Incidental Mutation 'R5330:Dchs1'

423150

Institutional Source

Beutler Lab

Gene Symbol

Dchs1

Ensembl Gene

ENSMUSG00000036862

Gene Name

dachsous cadherin related 1

Synonyms

3110041P15Rik, C130033F22Rik

MMRRC Submission

042912-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5330 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105752990-105787654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105754602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 2911 (V2911E)

Ref Sequence

ENSEMBL: ENSMUSP00000077574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033184

SMART Domains

Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
Pro-kuma_activ	32	176	4.53e-50	SMART
low complexity region	177	189	N/A	INTRINSIC
Pfam:Peptidase_S8	251	492	1.1e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000078482
AA Change: V2911E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: V2911E

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CA	58	135	5.2e-11	SMART
CA	159	247	6.1e-17	SMART
CA	271	354	2.6e-30	SMART
CA	382	464	7.8e-26	SMART
CA	489	570	1.2e-34	SMART
CA	594	677	1.9e-27	SMART
CA	701	782	5.3e-11	SMART
CA	806	886	1e-12	SMART
CA	910	990	3.3e-14	SMART
CA	1016	1097	3.6e-18	SMART
CA	1121	1203	3.1e-34	SMART
CA	1233	1307	8.8e-16	SMART
low complexity region	1323	1335	N/A	INTRINSIC
CA	1344	1427	9.9e-9	SMART
CA	1451	1537	1.5e-23	SMART
CA	1560	1640	7.2e-32	SMART
CA	1664	1742	1.8e-31	SMART
CA	1765	1846	7.8e-30	SMART
CA	1870	1951	3.7e-26	SMART
low complexity region	1957	1965	N/A	INTRINSIC
CA	1979	2059	1.1e-6	SMART
CA	2083	2162	2.7e-18	SMART
CA	2186	2268	2.2e-26	SMART
CA	2291	2367	1e-18	SMART
CA	2391	2473	1.8e-23	SMART
CA	2497	2593	3.5e-21	SMART
CA	2617	2697	1.2e-25	SMART
CA	2721	2804	1.9e-18	SMART
CA	2828	2919	3e-3	SMART
transmembrane domain	2932	2954	N/A	INTRINSIC
low complexity region	3001	3017	N/A	INTRINSIC
low complexity region	3046	3055	N/A	INTRINSIC
low complexity region	3088	3097	N/A	INTRINSIC
low complexity region	3185	3196	N/A	INTRINSIC
low complexity region	3237	3259	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140959

Predicted Effect

probably benign
Transcript: ENSMUST00000210066

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210395

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210840

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211204

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211226

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211659

Meta Mutation Damage Score

0.9280

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,091,858		probably benign	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
A2m	A	G	6: 121,638,416	D83G	probably benign	Het
Abca16	T	A	7: 120,503,377	I833N	probably benign	Het
Adam6b	C	A	12: 113,490,580	P339H	possibly damaging	Het
Adgrb2	A	T	4: 130,022,202	H1505L	possibly damaging	Het
Aktip	A	T	8: 91,126,724	F122I	probably damaging	Het
Ankrd27	T	A	7: 35,615,926	L500*	probably null	Het
Blm	T	C	7: 80,458,936	E55G	possibly damaging	Het
Carmil1	A	T	13: 24,025,946		probably null	Het
Cdca7	T	C	2: 72,484,698	C311R	probably damaging	Het
Cds1	T	C	5: 101,798,495	S187P	probably damaging	Het
Chuk	A	T	19: 44,078,955	V587E	probably damaging	Het
Commd10	T	C	18: 46,960,430	V19A	probably damaging	Het
Ctnnd2	C	T	15: 30,332,115	T48I	probably damaging	Het
Cyp2b10	T	A	7: 25,913,989	Y203*	probably null	Het
Dnah12	G	A	14: 26,773,830	E1472K	probably damaging	Het
Dnah3	T	C	7: 119,943,648	T3514A	probably benign	Het
Dnah6	T	A	6: 73,074,590	I3074F	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fam131c	A	T	4: 141,382,830	T180S	probably benign	Het
Fbxo41	T	C	6: 85,479,906	E427G	probably benign	Het
Gabrr2	A	G	4: 33,082,583	K236E	possibly damaging	Het
Gm10152	A	T	7: 144,763,546		noncoding transcript	Het
Gm10313	T	A	8: 46,255,453		noncoding transcript	Het
Gm5414	C	A	15: 101,624,664	V443F	probably damaging	Het
Gm7334	T	C	17: 50,699,132	S149P	possibly damaging	Het
Grik2	G	A	10: 49,132,771	T740M	probably damaging	Het
Hdac5	T	C	11: 102,197,354	Y930C	probably damaging	Het
Hepacam2	T	C	6: 3,483,377	T211A	probably benign	Het
Herc4	G	T	10: 63,307,799	E703*	probably null	Het
Hivep2	A	G	10: 14,131,420	K1254R	probably damaging	Het
Hras	T	C	7: 141,192,940	M1V	probably null	Het
Ikbkap	T	C	4: 56,800,001	T42A	probably benign	Het
Il23r	T	G	6: 67,423,495	Q617P	probably damaging	Het
Kank1	A	G	19: 25,411,329	T789A	probably damaging	Het
Kcnj12	A	G	11: 61,070,186	K437E	probably benign	Het
Lct	A	T	1: 128,298,529	D1374E	probably benign	Het
Luc7l	C	A	17: 26,275,733	C104*	probably null	Het
Lurap1	G	A	4: 116,144,404	L31F	probably damaging	Het
Mark4	G	A	7: 19,436,983	P321S	probably damaging	Het
Med18	A	G	4: 132,463,066		probably benign	Het
Mia2	A	G	12: 59,095,812	S5G	probably benign	Het
Mrgprb3	T	C	7: 48,642,934	T290A	possibly damaging	Het
Negr1	A	T	3: 157,069,276	K210*	probably null	Het
Nktr	T	C	9: 121,752,768		probably benign	Het
Nob1	T	G	8: 107,416,249	T267P	probably damaging	Het
Nos3	A	G	5: 24,369,904	E307G	probably damaging	Het
Nrxn2	A	G	19: 6,490,081	T796A	probably damaging	Het
Nwd2	C	A	5: 63,806,516	L1148I	probably benign	Het
Pcdh17	T	A	14: 84,533,046	V988E	probably damaging	Het
Pcdha4	G	A	18: 36,954,702	R646H	probably benign	Het
Per3	G	T	4: 151,041,302	L187I	probably damaging	Het
Phlpp2	A	G	8: 109,934,035	D774G	probably damaging	Het
Pibf1	T	C	14: 99,140,646	Y403H	probably damaging	Het
Plcl2	G	A	17: 50,509,848	A81T	probably benign	Het
Polr2a	T	C	11: 69,747,275	N123D	probably benign	Het
Psma5	T	G	3: 108,268,070	V146G	possibly damaging	Het
Ptprk	A	T	10: 28,587,080	D189V	probably damaging	Het
Relb	C	T	7: 19,606,705	G509S	possibly damaging	Het
Rgs11	A	T	17: 26,202,973	M1L	probably benign	Het
Rhbg	T	A	3: 88,245,468	T313S	probably benign	Het
Ripply2	T	A	9: 87,015,638		probably benign	Het
Scap	T	C	9: 110,381,633	V1011A	probably benign	Het
Scarf1	G	A	11: 75,515,580	G230D	probably damaging	Het
Sel1l3	A	T	5: 53,186,009	Y314N	possibly damaging	Het
Slc17a8	A	G	10: 89,589,494		probably null	Het
Slc22a14	A	T	9: 119,230,596	L153Q	probably damaging	Het
Slc22a27	A	G	19: 7,879,455	I406T	probably benign	Het
Slc30a6	A	G	17: 74,423,195	D355G	probably benign	Het
Snta1	C	A	2: 154,378,020	E403*	probably null	Het
Socs7	A	G	11: 97,378,026	D382G	possibly damaging	Het
Spata31d1a	A	T	13: 59,700,403	C1304S	possibly damaging	Het
Srebf2	T	A	15: 82,196,208	I834N	possibly damaging	Het
Steap1	G	T	5: 5,740,422	H175Q	probably damaging	Het
Sult2a8	T	C	7: 14,413,754	E204G	possibly damaging	Het
Tacc2	T	C	7: 130,733,528	S524P	probably damaging	Het
Tbc1d9b	C	T	11: 50,146,313	A263V	probably benign	Het
Tecta	A	C	9: 42,337,856	D1903E	probably damaging	Het
Tmem222	A	C	4: 133,277,624	M34R	possibly damaging	Het
Tnik	A	G	3: 28,542,018	T187A	probably damaging	Het
Trpv4	A	G	5: 114,635,543	Y253H	probably damaging	Het
Trpv5	G	A	6: 41,660,332	R358C	probably benign	Het
Ttll13	T	C	7: 80,260,509	V800A	probably benign	Het
Ush2a	G	A	1: 188,728,381	G2613E	probably benign	Het
Vmn2r58	G	A	7: 41,863,960	Q420*	probably null	Het
Zranb3	G	A	1: 127,959,720	P990L	probably damaging	Het
Zswim9	T	A	7: 13,259,985	D748V	probably damaging	Het

Other mutations in Dchs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Dchs1	APN	7	105758743	missense	probably damaging	1.00
IGL00422:Dchs1	APN	7	105758029	missense	possibly damaging	0.88
IGL00427:Dchs1	APN	7	105758424	missense	probably damaging	0.98
IGL00469:Dchs1	APN	7	105755261	missense	probably damaging	1.00
IGL00470:Dchs1	APN	7	105758207	missense	probably damaging	1.00
IGL00534:Dchs1	APN	7	105757943	missense	probably benign
IGL01292:Dchs1	APN	7	105760891	missense	probably damaging	0.98
IGL01380:Dchs1	APN	7	105762211	missense	probably damaging	1.00
IGL01396:Dchs1	APN	7	105772283	missense	probably damaging	1.00
IGL01448:Dchs1	APN	7	105771927	missense	probably damaging	0.98
IGL01759:Dchs1	APN	7	105755302	missense	probably benign	0.00
IGL01829:Dchs1	APN	7	105755397	missense	probably damaging	0.99
IGL01946:Dchs1	APN	7	105759105	missense	probably damaging	1.00
IGL01955:Dchs1	APN	7	105757591	missense	probably benign	0.00
IGL02012:Dchs1	APN	7	105764297	missense	probably damaging	0.98
IGL02222:Dchs1	APN	7	105764887	missense	probably damaging	1.00
IGL02261:Dchs1	APN	7	105772569	missense	probably damaging	1.00
IGL02365:Dchs1	APN	7	105755188	missense	probably benign	0.22
IGL02430:Dchs1	APN	7	105771971	missense	probably benign	0.34
IGL02500:Dchs1	APN	7	105755806	missense	probably benign
IGL02741:Dchs1	APN	7	105757323	missense	probably damaging	1.00
IGL02890:Dchs1	APN	7	105756491	missense	probably damaging	1.00
IGL03213:Dchs1	APN	7	105755072	missense	probably damaging	1.00
G1patch:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
P0026:Dchs1	UTSW	7	105758405	missense	probably damaging	0.99
PIT4377001:Dchs1	UTSW	7	105757588	missense	probably damaging	1.00
PIT4791001:Dchs1	UTSW	7	105758971	missense	probably damaging	1.00
R0013:Dchs1	UTSW	7	105755836	missense	possibly damaging	0.90
R0090:Dchs1	UTSW	7	105755932	missense	probably benign	0.18
R0091:Dchs1	UTSW	7	105766094	splice site	probably benign
R0193:Dchs1	UTSW	7	105764983	missense	probably benign	0.40
R0395:Dchs1	UTSW	7	105758538	missense	probably damaging	1.00
R0448:Dchs1	UTSW	7	105765927	missense	probably benign	0.00
R0480:Dchs1	UTSW	7	105771489	missense	probably benign	0.14
R0485:Dchs1	UTSW	7	105772727	missense	probably benign	0.00
R0566:Dchs1	UTSW	7	105759195	missense	probably benign	0.00
R0571:Dchs1	UTSW	7	105771996	missense	probably damaging	1.00
R0573:Dchs1	UTSW	7	105758778	missense	probably damaging	0.98
R0577:Dchs1	UTSW	7	105764255	missense	possibly damaging	0.78
R0622:Dchs1	UTSW	7	105763449	missense	probably damaging	1.00
R0654:Dchs1	UTSW	7	105772349	missense	probably damaging	1.00
R0677:Dchs1	UTSW	7	105764984	missense	probably damaging	1.00
R1171:Dchs1	UTSW	7	105757714	missense	probably benign
R1241:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R1389:Dchs1	UTSW	7	105755571	missense	probably benign	0.40
R1427:Dchs1	UTSW	7	105766191	missense	probably benign	0.06
R1458:Dchs1	UTSW	7	105755244	missense	probably damaging	1.00
R1513:Dchs1	UTSW	7	105772071	nonsense	probably null
R1524:Dchs1	UTSW	7	105764525	missense	probably damaging	1.00
R1525:Dchs1	UTSW	7	105758931	missense	probably damaging	1.00
R1534:Dchs1	UTSW	7	105772040	missense	probably damaging	0.98
R1567:Dchs1	UTSW	7	105771861	missense	probably benign	0.01
R1577:Dchs1	UTSW	7	105765955	missense	probably damaging	1.00
R1603:Dchs1	UTSW	7	105762770	missense	probably benign	0.24
R1676:Dchs1	UTSW	7	105754921	missense	probably benign	0.40
R1794:Dchs1	UTSW	7	105771720	missense	probably benign	0.02
R1826:Dchs1	UTSW	7	105757627	missense	probably damaging	1.00
R1892:Dchs1	UTSW	7	105764156	missense	probably benign	0.00
R1924:Dchs1	UTSW	7	105772280	missense	possibly damaging	0.81
R1932:Dchs1	UTSW	7	105765902	missense	probably damaging	1.00
R1962:Dchs1	UTSW	7	105764201	missense	probably damaging	1.00
R1985:Dchs1	UTSW	7	105772398	missense	possibly damaging	0.72
R1993:Dchs1	UTSW	7	105762548	missense	probably benign	0.00
R2007:Dchs1	UTSW	7	105755325	missense	probably damaging	1.00
R2316:Dchs1	UTSW	7	105764204	missense	possibly damaging	0.71
R2351:Dchs1	UTSW	7	105754094	missense	probably benign
R2474:Dchs1	UTSW	7	105755074	missense	probably benign	0.37
R2474:Dchs1	UTSW	7	105772838	missense	probably damaging	1.00
R3429:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3430:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3737:Dchs1	UTSW	7	105762316	missense	possibly damaging	0.88
R3767:Dchs1	UTSW	7	105757085	missense	possibly damaging	0.67
R3874:Dchs1	UTSW	7	105761635	missense	probably damaging	1.00
R3883:Dchs1	UTSW	7	105762563	missense	probably damaging	1.00
R4105:Dchs1	UTSW	7	105765140	missense	probably damaging	1.00
R4209:Dchs1	UTSW	7	105766190	missense	probably damaging	0.99
R4329:Dchs1	UTSW	7	105753759	missense	probably damaging	1.00
R4516:Dchs1	UTSW	7	105754852	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105754765	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105758973	missense	probably benign
R4588:Dchs1	UTSW	7	105756041	missense	probably benign
R4613:Dchs1	UTSW	7	105772724	missense	probably damaging	1.00
R4632:Dchs1	UTSW	7	105754355	missense	probably benign	0.02
R4696:Dchs1	UTSW	7	105764627	missense	probably damaging	1.00
R4725:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4725:Dchs1	UTSW	7	105765552	missense	probably damaging	1.00
R4738:Dchs1	UTSW	7	105758673	missense	probably damaging	0.96
R4768:Dchs1	UTSW	7	105771620	missense	possibly damaging	0.96
R4784:Dchs1	UTSW	7	105765926	missense	probably damaging	1.00
R4864:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4880:Dchs1	UTSW	7	105755730	missense	probably benign	0.00
R4909:Dchs1	UTSW	7	105766255	missense	probably damaging	1.00
R5102:Dchs1	UTSW	7	105772177	missense	probably benign	0.09
R5109:Dchs1	UTSW	7	105765014	missense	probably benign
R5126:Dchs1	UTSW	7	105753517	missense	probably damaging	1.00
R5149:Dchs1	UTSW	7	105755658	missense	probably damaging	0.98
R5384:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105772055	missense	probably damaging	1.00
R5386:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5622:Dchs1	UTSW	7	105755293	missense	probably benign	0.11
R5623:Dchs1	UTSW	7	105772769	missense	probably damaging	1.00
R5708:Dchs1	UTSW	7	105772809	missense	probably damaging	1.00
R5718:Dchs1	UTSW	7	105755748	missense	probably benign	0.01
R5743:Dchs1	UTSW	7	105771596	missense	probably benign
R5759:Dchs1	UTSW	7	105764176	missense	probably damaging	0.99
R5772:Dchs1	UTSW	7	105773040	missense	probably damaging	1.00
R5860:Dchs1	UTSW	7	105772035	missense	probably damaging	1.00
R5916:Dchs1	UTSW	7	105759166	missense	probably damaging	1.00
R5965:Dchs1	UTSW	7	105755925	missense	probably damaging	1.00
R5997:Dchs1	UTSW	7	105754095	missense	probably benign	0.08
R6065:Dchs1	UTSW	7	105755421	missense	probably damaging	1.00
R6136:Dchs1	UTSW	7	105760925	missense	probably benign
R6137:Dchs1	UTSW	7	105765106	missense	probably damaging	0.99
R6324:Dchs1	UTSW	7	105764938	missense	probably benign	0.05
R6363:Dchs1	UTSW	7	105758472	missense	probably benign	0.12
R6466:Dchs1	UTSW	7	105764541	missense	probably benign	0.09
R6544:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R6572:Dchs1	UTSW	7	105758806	missense	possibly damaging	0.94
R6579:Dchs1	UTSW	7	105762913	missense	probably benign	0.17
R6632:Dchs1	UTSW	7	105761878	missense	probably damaging	1.00
R6725:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
R6789:Dchs1	UTSW	7	105757003	missense	possibly damaging	0.61
R6868:Dchs1	UTSW	7	105763503	missense	possibly damaging	0.91
R7058:Dchs1	UTSW	7	105757021	missense	probably benign
R7064:Dchs1	UTSW	7	105763185	missense	probably damaging	0.99
R7076:Dchs1	UTSW	7	105761871	missense	probably benign	0.04
R7191:Dchs1	UTSW	7	105765439	missense	possibly damaging	0.89
R7298:Dchs1	UTSW	7	105755131	nonsense	probably null
R7380:Dchs1	UTSW	7	105758628	missense	probably benign	0.35
R7438:Dchs1	UTSW	7	105754948	missense	probably benign	0.30
R7496:Dchs1	UTSW	7	105761859	missense	probably damaging	1.00
R7534:Dchs1	UTSW	7	105772373	missense	probably benign	0.00
R7604:Dchs1	UTSW	7	105765982	missense	probably damaging	1.00
R7631:Dchs1	UTSW	7	105759238	missense	probably benign
R7821:Dchs1	UTSW	7	105765145	missense	probably benign	0.00
R7834:Dchs1	UTSW	7	105765567	missense	probably benign	0.39
R7841:Dchs1	UTSW	7	105762973	missense	probably benign
R7913:Dchs1	UTSW	7	105759228	missense	possibly damaging	0.61
R8041:Dchs1	UTSW	7	105755188	missense	probably benign	0.45
R8076:Dchs1	UTSW	7	105755921	missense	possibly damaging	0.52
R8076:Dchs1	UTSW	7	105761982	missense	probably damaging	1.00
R8087:Dchs1	UTSW	7	105753499	missense	probably benign	0.41
R8125:Dchs1	UTSW	7	105764882	missense	possibly damaging	0.91
R8223:Dchs1	UTSW	7	105762617	missense	possibly damaging	0.81
R8239:Dchs1	UTSW	7	105765511	missense	probably benign	0.22
R8476:Dchs1	UTSW	7	105758808	missense	probably benign	0.05
R8497:Dchs1	UTSW	7	105758961	missense	probably damaging	1.00
R8770:Dchs1	UTSW	7	105771738	missense	probably damaging	1.00
R8856:Dchs1	UTSW	7	105760857	missense	probably damaging	1.00
R8866:Dchs1	UTSW	7	105755390	missense	probably benign	0.00
R8948:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R8950:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R9029:Dchs1	UTSW	7	105753712	missense	probably benign	0.13
R9039:Dchs1	UTSW	7	105756008	missense	probably benign	0.11
R9081:Dchs1	UTSW	7	105754429	missense	probably benign	0.00
R9134:Dchs1	UTSW	7	105755703	missense	probably damaging	0.96
R9159:Dchs1	UTSW	7	105765919	missense	probably benign
R9162:Dchs1	UTSW	7	105765525	missense	probably damaging	1.00
R9169:Dchs1	UTSW	7	105772907	missense	probably damaging	1.00
R9262:Dchs1	UTSW	7	105755626	missense	probably damaging	1.00
R9292:Dchs1	UTSW	7	105753913	missense	probably damaging	1.00
R9325:Dchs1	UTSW	7	105766195	missense	possibly damaging	0.51
R9376:Dchs1	UTSW	7	105765774	critical splice donor site	probably null
R9392:Dchs1	UTSW	7	105772662	missense	probably benign	0.09
R9619:Dchs1	UTSW	7	105764455	missense	probably benign	0.07
R9680:Dchs1	UTSW	7	105762418	missense	probably damaging	1.00
R9687:Dchs1	UTSW	7	105757984	missense	probably damaging	0.99
R9747:Dchs1	UTSW	7	105763475	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105757693	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105758551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGATACAGATGTTCAGAGGGTG -3'
(R):5'- AACCAGACAACAGGTGCTTTG -3'

Sequencing Primer
(F):5'- CCCAGTTTCTGTAAAGAGCTACTGG -3'
(R):5'- CCAGACAACAGGTGCTTTGTACTTG -3'

Posted On

2016-08-04