Incidental Mutation 'R5331:Gabrr2'
ID423216
Institutional Source Beutler Lab
Gene Symbol Gabrr2
Ensembl Gene ENSMUSG00000023267
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 2
Synonyms
MMRRC Submission 042913-MU
Accession Numbers

Genbank: NM_008076; MGI: 95626; Ensembl: ENSMUST00000108162, ENSMUST00000147889, ENSMUST00000131920, ENSMUST00000024035

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5331 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location33062999-33095865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33082583 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 236 (K236E)
Ref Sequence ENSEMBL: ENSMUSP00000024035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024035] [ENSMUST00000108162] [ENSMUST00000131920]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024035
AA Change: K236E

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024035
Gene: ENSMUSG00000023267
AA Change: K236E

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 81 286 3.4e-53 PFAM
Pfam:Neur_chan_memb 293 454 1.9e-32 PFAM
transmembrane domain 472 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108162
AA Change: K211E

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103797
Gene: ENSMUSG00000023267
AA Change: K211E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 261 9.7e-57 PFAM
Pfam:Neur_chan_memb 268 414 4.2e-36 PFAM
transmembrane domain 447 464 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131920
AA Change: K112E

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118514
Gene: ENSMUSG00000023267
AA Change: K112E

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 162 3.3e-46 PFAM
Pfam:Neur_chan_memb 169 204 3.5e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000147889
AA Change: K56E
SMART Domains Protein: ENSMUSP00000114337
Gene: ENSMUSG00000023267
AA Change: K56E

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 107 7.1e-28 PFAM
Pfam:Neur_chan_memb 114 219 1.1e-33 PFAM
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
A2m A G 6: 121,638,416 D83G probably benign Het
Ablim1 T C 19: 57,155,249 T80A probably damaging Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Ankrd46 G A 15: 36,486,029 T26I probably benign Het
Bmpr1b T C 3: 141,856,415 N337S probably damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cct5 A G 15: 31,594,302 probably benign Het
Cdca2 T C 14: 67,677,471 K780E possibly damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Ces3a G A 8: 105,057,556 E416K probably damaging Het
Chd8 T A 14: 52,202,114 probably benign Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctsa A G 2: 164,834,309 probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dydc1 T C 14: 41,082,363 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Enpp3 T A 10: 24,808,160 N227I probably damaging Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fam193a C A 5: 34,465,571 probably null Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm18025 C T 12: 34,290,575 C173Y probably benign Het
Gm1966 T C 7: 106,598,751 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Gpaa1 T A 15: 76,332,311 probably benign Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Insc T A 7: 114,845,038 M420K probably damaging Het
Ints10 A T 8: 68,820,820 probably null Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kat6a T A 8: 22,939,984 L1785Q unknown Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Knl1 T A 2: 119,070,255 D812E possibly damaging Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mon1b C T 8: 113,636,267 T49I probably null Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Mxd3 T C 13: 55,329,258 probably benign Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nek7 A T 1: 138,498,574 probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Olfr1176 T C 2: 88,339,988 L141P probably damaging Het
Osmr G C 15: 6,842,881 T244S probably damaging Het
Ovol3 T C 7: 30,233,479 D177G possibly damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Pdilt T C 7: 119,514,924 E117G possibly damaging Het
Pecr A G 1: 72,274,846 probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Prex2 T A 1: 11,140,011 D558E possibly damaging Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rgsl1 T C 1: 153,802,292 N130S probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Sphkap A G 1: 83,276,782 V1082A probably benign Het
Stox2 G A 8: 47,413,627 probably benign Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tekt5 C T 16: 10,361,329 M391I probably benign Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Themis2 T C 4: 132,782,933 D652G possibly damaging Het
Tmem185b A G 1: 119,527,592 probably benign Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Usp25 C A 16: 77,050,558 Q185K probably damaging Het
Xkr5 G A 8: 18,933,468 probably benign Het
Zfp541 C T 7: 16,095,758 P1331S probably damaging Het
Other mutations in Gabrr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gabrr2 APN 4 33085626 missense probably damaging 1.00
IGL02070:Gabrr2 APN 4 33095340 nonsense probably null
IGL03283:Gabrr2 APN 4 33082364 splice site probably benign
D3080:Gabrr2 UTSW 4 33084466 missense probably damaging 1.00
R1250:Gabrr2 UTSW 4 33063273 missense probably benign 0.20
R1381:Gabrr2 UTSW 4 33081420 missense probably damaging 1.00
R1630:Gabrr2 UTSW 4 33085647 missense probably damaging 1.00
R1782:Gabrr2 UTSW 4 33085593 missense probably damaging 1.00
R1830:Gabrr2 UTSW 4 33077481 missense probably damaging 1.00
R2000:Gabrr2 UTSW 4 33084400 missense probably damaging 1.00
R2125:Gabrr2 UTSW 4 33095548 missense probably damaging 1.00
R2679:Gabrr2 UTSW 4 33071435 missense probably damaging 1.00
R3695:Gabrr2 UTSW 4 33071430 missense probably damaging 1.00
R3891:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R3892:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R4902:Gabrr2 UTSW 4 33095512 missense probably damaging 1.00
R5328:Gabrr2 UTSW 4 33082565 missense probably damaging 1.00
R5330:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5399:Gabrr2 UTSW 4 33071458 critical splice donor site probably null
R7299:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7301:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7605:Gabrr2 UTSW 4 33082560 missense probably damaging 1.00
R7697:Gabrr2 UTSW 4 33071358 missense probably benign
R7860:Gabrr2 UTSW 4 33081470 nonsense probably null
R7943:Gabrr2 UTSW 4 33081470 nonsense probably null
X0017:Gabrr2 UTSW 4 33082328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACATGGACTTCAGCCAC -3'
(R):5'- ACCCTATGTGTTGGAAGTGGC -3'

Sequencing Primer
(F):5'- CCAGACCTGCTCTTTGGAG -3'
(R):5'- CCTATGTGTTGGAAGTGGCAAAGG -3'
Posted On2016-08-04