Incidental Mutation 'R5331:Gm1966'
ID423236
Institutional Source Beutler Lab
Gene Symbol Gm1966
Ensembl Gene ENSMUSG00000073902
Gene Namepredicted gene 1966
Synonyms
MMRRC Submission 042913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5331 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106596743-106604035 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 106598751 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184540
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (99/99)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
A2m A G 6: 121,638,416 D83G probably benign Het
Ablim1 T C 19: 57,155,249 T80A probably damaging Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Ankrd46 G A 15: 36,486,029 T26I probably benign Het
Bmpr1b T C 3: 141,856,415 N337S probably damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cct5 A G 15: 31,594,302 probably benign Het
Cdca2 T C 14: 67,677,471 K780E possibly damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Ces3a G A 8: 105,057,556 E416K probably damaging Het
Chd8 T A 14: 52,202,114 probably benign Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctsa A G 2: 164,834,309 probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dydc1 T C 14: 41,082,363 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Enpp3 T A 10: 24,808,160 N227I probably damaging Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fam193a C A 5: 34,465,571 probably null Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm18025 C T 12: 34,290,575 C173Y probably benign Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Gpaa1 T A 15: 76,332,311 probably benign Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Insc T A 7: 114,845,038 M420K probably damaging Het
Ints10 A T 8: 68,820,820 probably null Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kat6a T A 8: 22,939,984 L1785Q unknown Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Knl1 T A 2: 119,070,255 D812E possibly damaging Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mon1b C T 8: 113,636,267 T49I probably null Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Mxd3 T C 13: 55,329,258 probably benign Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nek7 A T 1: 138,498,574 probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Olfr1176 T C 2: 88,339,988 L141P probably damaging Het
Osmr G C 15: 6,842,881 T244S probably damaging Het
Ovol3 T C 7: 30,233,479 D177G possibly damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Pdilt T C 7: 119,514,924 E117G possibly damaging Het
Pecr A G 1: 72,274,846 probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Prex2 T A 1: 11,140,011 D558E possibly damaging Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rgsl1 T C 1: 153,802,292 N130S probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Sphkap A G 1: 83,276,782 V1082A probably benign Het
Stox2 G A 8: 47,413,627 probably benign Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tekt5 C T 16: 10,361,329 M391I probably benign Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Themis2 T C 4: 132,782,933 D652G possibly damaging Het
Tmem185b A G 1: 119,527,592 probably benign Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Usp25 C A 16: 77,050,558 Q185K probably damaging Het
Xkr5 G A 8: 18,933,468 probably benign Het
Zfp541 C T 7: 16,095,758 P1331S probably damaging Het
Other mutations in Gm1966
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Gm1966 APN 7 106602035 missense probably benign 0.10
IGL01410:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01415:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01538:Gm1966 APN 7 106602537 missense probably damaging 0.96
IGL01751:Gm1966 APN 7 106602309 missense possibly damaging 0.80
IGL01916:Gm1966 APN 7 106601826 missense probably benign 0.28
IGL02171:Gm1966 APN 7 106601341 exon noncoding transcript
IGL02550:Gm1966 APN 7 106601639 exon noncoding transcript
H8562:Gm1966 UTSW 7 106603149 missense probably damaging 1.00
R0016:Gm1966 UTSW 7 106603246 missense probably benign 0.00
R0178:Gm1966 UTSW 7 106601821 missense probably damaging 1.00
R0420:Gm1966 UTSW 7 106603883 missense probably damaging 1.00
R0658:Gm1966 UTSW 7 106602886 missense possibly damaging 0.89
R1378:Gm1966 UTSW 7 106602166 missense probably damaging 0.97
R1506:Gm1966 UTSW 7 106601581 missense probably benign 0.08
R1628:Gm1966 UTSW 7 106603269 nonsense probably null
R1834:Gm1966 UTSW 7 106603776 missense possibly damaging 0.79
R1888:Gm1966 UTSW 7 106597423 exon noncoding transcript
R2145:Gm1966 UTSW 7 106603008 missense possibly damaging 0.84
R4056:Gm1966 UTSW 7 106604009 missense possibly damaging 0.59
R4067:Gm1966 UTSW 7 106599565 exon noncoding transcript
R4631:Gm1966 UTSW 7 106599523 exon noncoding transcript
R4817:Gm1966 UTSW 7 106601230 exon noncoding transcript
R4900:Gm1966 UTSW 7 106598586 exon noncoding transcript
R4970:Gm1966 UTSW 7 106600657 exon noncoding transcript
R5009:Gm1966 UTSW 7 106601560 exon noncoding transcript
R5050:Gm1966 UTSW 7 106596972 exon noncoding transcript
R5086:Gm1966 UTSW 7 106598027 exon noncoding transcript
R5090:Gm1966 UTSW 7 106600902 exon noncoding transcript
R5168:Gm1966 UTSW 7 106596847 exon noncoding transcript
R5260:Gm1966 UTSW 7 106599204 exon noncoding transcript
R5389:Gm1966 UTSW 7 106598235 exon noncoding transcript
R5433:Gm1966 UTSW 7 106600107 exon noncoding transcript
R5488:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5489:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5504:Gm1966 UTSW 7 106602744 exon noncoding transcript
R5956:Gm1966 UTSW 7 106601470 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCTTTCCACTGAACCAATATTTCAC -3'
(R):5'- ATTGCTACAATGTCCAGGAACTAAG -3'

Sequencing Primer
(F):5'- GAACCAATATTTCACTATCTGGGTC -3'
(R):5'- GTCCAGGAACTAAGAAATGCAATTC -3'
Posted On2016-08-04