Incidental Mutation 'R5331:Tacc2'
ID423239
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 042913-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5331 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130733528 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 524 (S524P)
Ref Sequence ENSEMBL: ENSMUSP00000147134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033141] [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207282] [ENSMUST00000207376] [ENSMUST00000207395] [ENSMUST00000207549] [ENSMUST00000207789] [ENSMUST00000208722] [ENSMUST00000208743] [ENSMUST00000209108]
Predicted Effect probably damaging
Transcript: ENSMUST00000033141
AA Change: S524P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033141
Gene: ENSMUSG00000030852
AA Change: S524P

DomainStartEndE-ValueType
low complexity region 37 63 N/A INTRINSIC
internal_repeat_1 71 181 1.04e-5 PROSPERO
low complexity region 235 246 N/A INTRINSIC
internal_repeat_2 258 345 6.53e-5 PROSPERO
internal_repeat_1 373 456 1.04e-5 PROSPERO
low complexity region 461 476 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
internal_repeat_2 629 716 6.53e-5 PROSPERO
coiled coil region 763 790 N/A INTRINSIC
Pfam:TACC 829 1035 3.4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059145
AA Change: S634P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: S634P

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084513
AA Change: S2341P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: S2341P

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207282
AA Change: S512P

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000207376
AA Change: S153P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000207395
AA Change: S368P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207549
AA Change: S133P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably damaging
Transcript: ENSMUST00000208722
AA Change: S634P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208743
AA Change: S524P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209108
AA Change: S137P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1570 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
A2m A G 6: 121,638,416 D83G probably benign Het
Ablim1 T C 19: 57,155,249 T80A probably damaging Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Ankrd46 G A 15: 36,486,029 T26I probably benign Het
Bmpr1b T C 3: 141,856,415 N337S probably damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cct5 A G 15: 31,594,302 probably benign Het
Cdca2 T C 14: 67,677,471 K780E possibly damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Ces3a G A 8: 105,057,556 E416K probably damaging Het
Chd8 T A 14: 52,202,114 probably benign Het
Chuk A T 19: 44,078,955 V587E probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctsa A G 2: 164,834,309 probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dydc1 T C 14: 41,082,363 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Enpp3 T A 10: 24,808,160 N227I probably damaging Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fam193a C A 5: 34,465,571 probably null Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm18025 C T 12: 34,290,575 C173Y probably benign Het
Gm1966 T C 7: 106,598,751 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Gpaa1 T A 15: 76,332,311 probably benign Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Insc T A 7: 114,845,038 M420K probably damaging Het
Ints10 A T 8: 68,820,820 probably null Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kat6a T A 8: 22,939,984 L1785Q unknown Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Knl1 T A 2: 119,070,255 D812E possibly damaging Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mon1b C T 8: 113,636,267 T49I probably null Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Mxd3 T C 13: 55,329,258 probably benign Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nek7 A T 1: 138,498,574 probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Olfr1176 T C 2: 88,339,988 L141P probably damaging Het
Osmr G C 15: 6,842,881 T244S probably damaging Het
Ovol3 T C 7: 30,233,479 D177G possibly damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Pdilt T C 7: 119,514,924 E117G possibly damaging Het
Pecr A G 1: 72,274,846 probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Prex2 T A 1: 11,140,011 D558E possibly damaging Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rgsl1 T C 1: 153,802,292 N130S probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Sphkap A G 1: 83,276,782 V1082A probably benign Het
Stox2 G A 8: 47,413,627 probably benign Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tekt5 C T 16: 10,361,329 M391I probably benign Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Themis2 T C 4: 132,782,933 D652G possibly damaging Het
Tmem185b A G 1: 119,527,592 probably benign Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Usp25 C A 16: 77,050,558 Q185K probably damaging Het
Xkr5 G A 8: 18,933,468 probably benign Het
Zfp541 C T 7: 16,095,758 P1331S probably damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
aces UTSW 7 130733528 missense probably damaging 1.00
Jacks UTSW 7 130625764 missense probably damaging 0.98
kings UTSW 7 130623483 missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130728888 missense probably benign 0.16
R7150:Tacc2 UTSW 7 130729077 missense probably benign
R7290:Tacc2 UTSW 7 130729373 missense probably benign 0.07
R7404:Tacc2 UTSW 7 130623336 missense probably benign 0.22
R7460:Tacc2 UTSW 7 130624633 missense probably benign 0.39
R7651:Tacc2 UTSW 7 130623154 missense probably benign 0.25
R7666:Tacc2 UTSW 7 130716814 start gained probably benign
R7695:Tacc2 UTSW 7 130728903 missense probably benign 0.08
R7766:Tacc2 UTSW 7 130743598 missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130623113 missense probably benign 0.34
R7861:Tacc2 UTSW 7 130625431 missense probably benign 0.00
R7944:Tacc2 UTSW 7 130625431 missense probably benign 0.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130623370 missense not run
Z1176:Tacc2 UTSW 7 130624270 missense not run
Z1176:Tacc2 UTSW 7 130744597 missense not run
Z1177:Tacc2 UTSW 7 130624980 missense not run
Z1177:Tacc2 UTSW 7 130625774 missense not run
Z1177:Tacc2 UTSW 7 130734949 missense not run
Predicted Primers PCR Primer
(F):5'- TAAAGGTCTCCAGCTTGGTGG -3'
(R):5'- CTTGTTAGAAACACAGCTAAGAGGG -3'

Sequencing Primer
(F):5'- CCAGCTTGGTGGGTCTTCC -3'
(R):5'- CAGTTGTGAACCACCATGTG -3'
Posted On2016-08-04