Incidental Mutation 'R0487:AI314180'
ID42327
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission 038686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R0487 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58819155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1265 (V1265A)
Ref Sequence ENSEMBL: ENSMUSP00000117585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]
Predicted Effect probably damaging
Transcript: ENSMUST00000102889
AA Change: V1265A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: V1265A

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135601
Predicted Effect probably damaging
Transcript: ENSMUST00000149301
AA Change: V1265A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: V1265A

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zap70 G T 1: 36,779,284 V351L probably damaging Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense probably damaging 1.00
BB016:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7929:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R8010:AI314180 UTSW 4 58832681 missense unknown
R8082:AI314180 UTSW 4 58807852 missense probably benign 0.00
R8175:AI314180 UTSW 4 58872756 missense probably damaging 1.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCCTGAAGACATGAGGCATAAC -3'
(R):5'- AGGCCAGCTTCACTAATGTCCCTG -3'

Sequencing Primer
(F):5'- GCCGATGCCAATAGAATAATATGC -3'
(R):5'- ACTAATGTCCCTGCTCTTTGTATG -3'
Posted On2013-05-23