Incidental Mutation 'R5331:Chuk'
ID423292
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission 042913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5331 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44078955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 587 (V587E)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably damaging
Transcript: ENSMUST00000026217
AA Change: V587E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: V587E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119591
AA Change: V587E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: V587E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149091
Meta Mutation Damage Score 0.6638 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,091,858 probably benign Het
A2m A G 6: 121,638,416 D83G probably benign Het
Ablim1 T C 19: 57,155,249 T80A probably damaging Het
Adam6b C A 12: 113,490,580 P339H possibly damaging Het
Adgrb2 A T 4: 130,022,202 H1505L possibly damaging Het
Ankrd46 G A 15: 36,486,029 T26I probably benign Het
Bmpr1b T C 3: 141,856,415 N337S probably damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cct5 A G 15: 31,594,302 probably benign Het
Cdca2 T C 14: 67,677,471 K780E possibly damaging Het
Cds1 T C 5: 101,798,495 S187P probably damaging Het
Ces3a G A 8: 105,057,556 E416K probably damaging Het
Chd8 T A 14: 52,202,114 probably benign Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Commd10 T C 18: 46,960,430 V19A probably damaging Het
Ctsa A G 2: 164,834,309 probably benign Het
Dnah6 T A 6: 73,074,590 I3074F probably damaging Het
Dydc1 T C 14: 41,082,363 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Enpp3 T A 10: 24,808,160 N227I probably damaging Het
Fam131c A T 4: 141,382,830 T180S probably benign Het
Fam193a C A 5: 34,465,571 probably null Het
Fbxo41 T C 6: 85,479,906 E427G probably benign Het
Gabrr2 A G 4: 33,082,583 K236E possibly damaging Het
Gm10152 A T 7: 144,763,546 noncoding transcript Het
Gm18025 C T 12: 34,290,575 C173Y probably benign Het
Gm1966 T C 7: 106,598,751 noncoding transcript Het
Gm5414 C A 15: 101,624,664 V443F probably damaging Het
Gm7334 T C 17: 50,699,132 S149P possibly damaging Het
Gpaa1 T A 15: 76,332,311 probably benign Het
Grik2 G A 10: 49,132,771 T740M probably damaging Het
Hdac5 T C 11: 102,197,354 Y930C probably damaging Het
Hepacam2 T C 6: 3,483,377 T211A probably benign Het
Herc4 G T 10: 63,307,799 E703* probably null Het
Hras T C 7: 141,192,940 M1V probably null Het
Ikbkap T C 4: 56,800,001 T42A probably benign Het
Il23r T G 6: 67,423,495 Q617P probably damaging Het
Insc T A 7: 114,845,038 M420K probably damaging Het
Ints10 A T 8: 68,820,820 probably null Het
Kank1 A G 19: 25,411,329 T789A probably damaging Het
Kat6a T A 8: 22,939,984 L1785Q unknown Het
Kcnj12 A G 11: 61,070,186 K437E probably benign Het
Knl1 T A 2: 119,070,255 D812E possibly damaging Het
Luc7l C A 17: 26,275,733 C104* probably null Het
Lurap1 G A 4: 116,144,404 L31F probably damaging Het
Mia2 A G 12: 59,095,812 S5G probably benign Het
Mon1b C T 8: 113,636,267 T49I probably null Het
Mrgprb3 T C 7: 48,642,934 T290A possibly damaging Het
Mxd3 T C 13: 55,329,258 probably benign Het
Negr1 A T 3: 157,069,276 K210* probably null Het
Nek7 A T 1: 138,498,574 probably null Het
Nktr T C 9: 121,752,768 probably benign Het
Nrxn2 A G 19: 6,490,081 T796A probably damaging Het
Nwd2 C A 5: 63,806,516 L1148I probably benign Het
Olfr1176 T C 2: 88,339,988 L141P probably damaging Het
Osmr G C 15: 6,842,881 T244S probably damaging Het
Ovol3 T C 7: 30,233,479 D177G possibly damaging Het
Pcdha4 G A 18: 36,954,702 R646H probably benign Het
Pdilt T C 7: 119,514,924 E117G possibly damaging Het
Pecr A G 1: 72,274,846 probably benign Het
Per3 G T 4: 151,041,302 L187I probably damaging Het
Plcl2 G A 17: 50,509,848 A81T probably benign Het
Polr2a T C 11: 69,747,275 N123D probably benign Het
Prex2 T A 1: 11,140,011 D558E possibly damaging Het
Psma5 T G 3: 108,268,070 V146G possibly damaging Het
Rgs11 A T 17: 26,202,973 M1L probably benign Het
Rgsl1 T C 1: 153,802,292 N130S probably benign Het
Rhbg T A 3: 88,245,468 T313S probably benign Het
Ripply2 T A 9: 87,015,638 probably benign Het
Scap T C 9: 110,381,633 V1011A probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scarf1 G A 11: 75,515,580 G230D probably damaging Het
Slc17a8 A G 10: 89,589,494 probably null Het
Slc22a14 A T 9: 119,230,596 L153Q probably damaging Het
Slc22a27 A G 19: 7,879,455 I406T probably benign Het
Slc30a6 A G 17: 74,423,195 D355G probably benign Het
Socs7 A G 11: 97,378,026 D382G possibly damaging Het
Sphkap A G 1: 83,276,782 V1082A probably benign Het
Stox2 G A 8: 47,413,627 probably benign Het
Tacc2 T C 7: 130,733,528 S524P probably damaging Het
Tbc1d9b C T 11: 50,146,313 A263V probably benign Het
Tekt5 C T 16: 10,361,329 M391I probably benign Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Themis2 T C 4: 132,782,933 D652G possibly damaging Het
Tmem185b A G 1: 119,527,592 probably benign Het
Trpv4 A G 5: 114,635,543 Y253H probably damaging Het
Trpv5 G A 6: 41,660,332 R358C probably benign Het
Ush2a G A 1: 188,728,381 G2613E probably benign Het
Usp25 C A 16: 77,050,558 Q185K probably damaging Het
Xkr5 G A 8: 18,933,468 probably benign Het
Zfp541 C T 7: 16,095,758 P1331S probably damaging Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGCATATGTTCAGGGCTTACAC -3'
(R):5'- AGCTAAGACAACAGCAGTGC -3'

Sequencing Primer
(F):5'- ACACAGCACCATGTTTTATAAGATAC -3'
(R):5'- GTGCCACACTTCAAGGACAGTG -3'
Posted On2016-08-04