Incidental Mutation 'R5333:4930430A15Rik'
ID423336
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene NameRIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission 042915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5333 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111162061-111229602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111194337 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 61 (Y61N)
Ref Sequence ENSEMBL: ENSMUSP00000117759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000142636]
Predicted Effect unknown
Transcript: ENSMUST00000028577
AA Change: Y433N
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: Y433N

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142636
AA Change: Y61N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117759
Gene: ENSMUSG00000027157
AA Change: Y61N

DomainStartEndE-ValueType
internal_repeat_1 1 69 7.48e-6 PROSPERO
internal_repeat_1 81 153 7.48e-6 PROSPERO
low complexity region 168 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abca14 T A 7: 120,289,546 Y1238* probably null Het
Abcb5 A T 12: 118,867,942 V1225D probably damaging Het
Arhgef15 A G 11: 68,947,196 probably benign Het
As3mt A G 19: 46,708,196 R58G probably null Het
Asap1 T G 15: 64,127,414 N525T possibly damaging Het
Bhmt2 A G 13: 93,671,430 V50A probably benign Het
Ccdc180 A T 4: 45,890,935 I36F possibly damaging Het
Cd209c A G 8: 3,944,976 S63P probably damaging Het
Cdc37 T C 9: 21,143,161 E56G possibly damaging Het
Cdkal1 T C 13: 29,326,152 Y541C probably benign Het
Cenph G T 13: 100,761,772 H208N probably benign Het
Cfap65 A T 1: 74,903,175 L1740Q probably benign Het
Cfap74 A G 4: 155,436,740 D623G probably damaging Het
Ckap4 C A 10: 84,527,610 V530L probably damaging Het
Cldn13 A T 5: 134,915,015 N105K probably benign Het
Ddn T C 15: 98,805,356 D685G possibly damaging Het
Fam155a T A 8: 9,770,762 Q86L possibly damaging Het
Fdxr T C 11: 115,272,258 I70V probably benign Het
Fn1 A T 1: 71,624,180 Y1050N probably damaging Het
Impad1 A C 4: 4,767,963 V271G possibly damaging Het
Iqcf3 A G 9: 106,553,661 I96T possibly damaging Het
Itgax A G 7: 128,142,283 Y822C probably damaging Het
Katnb1 A T 8: 95,095,606 I286L possibly damaging Het
Lrp2 A C 2: 69,525,228 I424R probably benign Het
Lrpprc C A 17: 84,790,393 A41S probably benign Het
Mast3 A G 8: 70,783,501 L761P probably benign Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mpp4 C A 1: 59,157,441 R44L probably benign Het
Nkain3 T A 4: 20,484,889 M63L probably benign Het
Nup88 A C 11: 70,945,016 probably benign Het
Obscn A T 11: 59,062,692 C3837S probably damaging Het
Ogdh T G 11: 6,352,126 L850V probably damaging Het
Olfr1131 A G 2: 87,629,114 Y217C probably damaging Het
Olfr1293-ps A G 2: 111,527,703 I148V probably benign Het
Panx2 T C 15: 89,068,539 I411T possibly damaging Het
Papss1 T A 3: 131,643,044 M585K probably damaging Het
Pcbp2 T G 15: 102,486,021 L180R possibly damaging Het
Pcdha7 A T 18: 36,974,566 T215S probably benign Het
Pcdhga4 C T 18: 37,685,424 R9C probably benign Het
Plin4 A G 17: 56,104,970 V687A probably benign Het
Psma6 A G 12: 55,407,428 probably benign Het
Rcn1 A T 2: 105,389,126 S241T probably benign Het
Scgb2b18 A T 7: 33,173,275 L35H probably damaging Het
Slc11a1 A C 1: 74,384,145 D385A probably damaging Het
Stk31 T A 6: 49,469,152 C930S probably benign Het
Syt10 T A 15: 89,841,729 Q14L probably benign Het
Tnxb T G 17: 34,690,231 W1578G probably damaging Het
Triml1 C T 8: 43,130,290 A425T possibly damaging Het
Vil1 G A 1: 74,432,390 V777I probably benign Het
Vmn1r175 T C 7: 23,808,579 I208V possibly damaging Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8421:4930430A15Rik UTSW 2 111218610 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTATGAAATGAGCTGATTCCGC -3'
(R):5'- ACTCAACCATTACTTGACACATGTG -3'

Sequencing Primer
(F):5'- GAAATGAGCTGATTCCGCCATTTTTC -3'
(R):5'- CCATTACTTGACACATGTGATAAAAC -3'
Posted On2016-08-04