Incidental Mutation 'R5333:Papss1'
ID423338
Institutional Source Beutler Lab
Gene Symbol Papss1
Ensembl Gene ENSMUSG00000028032
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 1
SynonymsAsapk, SK1
MMRRC Submission 042915-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R5333 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131564768-131643671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131643044 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 585 (M585K)
Ref Sequence ENSEMBL: ENSMUSP00000142616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029666] [ENSMUST00000197402] [ENSMUST00000199878] [ENSMUST00000200527]
Predicted Effect probably damaging
Transcript: ENSMUST00000029666
AA Change: M606K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029666
Gene: ENSMUSG00000028032
AA Change: M606K

DomainStartEndE-ValueType
Pfam:APS_kinase 51 209 5.6e-78 PFAM
Pfam:AAA_17 54 184 1.7e-7 PFAM
Pfam:AAA_33 55 182 4.4e-9 PFAM
Pfam:PUA_2 225 386 3.3e-51 PFAM
Pfam:ATP-sulfurylase 394 617 7.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197402
Predicted Effect probably damaging
Transcript: ENSMUST00000199878
AA Change: M585K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142533
Gene: ENSMUSG00000028032
AA Change: M585K

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200527
AA Change: M585K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142616
Gene: ENSMUSG00000028032
AA Change: M585K

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Meta Mutation Damage Score 0.8581 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS) is the sulfate donor cosubstrate for all sulfotransferase (SULT) enzymes (Xu et al., 2000 [PubMed 10679223]). SULTs catalyze the sulfate conjugation of many endogenous and exogenous compounds, including drugs and other xenobiotics. In humans, PAPS is synthesized from adenosine 5-prime triphosphate (ATP) and inorganic sulfate by 2 isoforms, PAPSS1 and PAPSS2 (MIM 603005).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,194,337 Y61N possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abca14 T A 7: 120,289,546 Y1238* probably null Het
Abcb5 A T 12: 118,867,942 V1225D probably damaging Het
Arhgef15 A G 11: 68,947,196 probably benign Het
As3mt A G 19: 46,708,196 R58G probably null Het
Asap1 T G 15: 64,127,414 N525T possibly damaging Het
Bhmt2 A G 13: 93,671,430 V50A probably benign Het
Ccdc180 A T 4: 45,890,935 I36F possibly damaging Het
Cd209c A G 8: 3,944,976 S63P probably damaging Het
Cdc37 T C 9: 21,143,161 E56G possibly damaging Het
Cdkal1 T C 13: 29,326,152 Y541C probably benign Het
Cenph G T 13: 100,761,772 H208N probably benign Het
Cfap65 A T 1: 74,903,175 L1740Q probably benign Het
Cfap74 A G 4: 155,436,740 D623G probably damaging Het
Ckap4 C A 10: 84,527,610 V530L probably damaging Het
Cldn13 A T 5: 134,915,015 N105K probably benign Het
Ddn T C 15: 98,805,356 D685G possibly damaging Het
Fam155a T A 8: 9,770,762 Q86L possibly damaging Het
Fdxr T C 11: 115,272,258 I70V probably benign Het
Fn1 A T 1: 71,624,180 Y1050N probably damaging Het
Impad1 A C 4: 4,767,963 V271G possibly damaging Het
Iqcf3 A G 9: 106,553,661 I96T possibly damaging Het
Itgax A G 7: 128,142,283 Y822C probably damaging Het
Katnb1 A T 8: 95,095,606 I286L possibly damaging Het
Lrp2 A C 2: 69,525,228 I424R probably benign Het
Lrpprc C A 17: 84,790,393 A41S probably benign Het
Mast3 A G 8: 70,783,501 L761P probably benign Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mpp4 C A 1: 59,157,441 R44L probably benign Het
Nkain3 T A 4: 20,484,889 M63L probably benign Het
Nup88 A C 11: 70,945,016 probably benign Het
Obscn A T 11: 59,062,692 C3837S probably damaging Het
Ogdh T G 11: 6,352,126 L850V probably damaging Het
Olfr1131 A G 2: 87,629,114 Y217C probably damaging Het
Olfr1293-ps A G 2: 111,527,703 I148V probably benign Het
Panx2 T C 15: 89,068,539 I411T possibly damaging Het
Pcbp2 T G 15: 102,486,021 L180R possibly damaging Het
Pcdha7 A T 18: 36,974,566 T215S probably benign Het
Pcdhga4 C T 18: 37,685,424 R9C probably benign Het
Plin4 A G 17: 56,104,970 V687A probably benign Het
Psma6 A G 12: 55,407,428 probably benign Het
Rcn1 A T 2: 105,389,126 S241T probably benign Het
Scgb2b18 A T 7: 33,173,275 L35H probably damaging Het
Slc11a1 A C 1: 74,384,145 D385A probably damaging Het
Stk31 T A 6: 49,469,152 C930S probably benign Het
Syt10 T A 15: 89,841,729 Q14L probably benign Het
Tnxb T G 17: 34,690,231 W1578G probably damaging Het
Triml1 C T 8: 43,130,290 A425T possibly damaging Het
Vil1 G A 1: 74,432,390 V777I probably benign Het
Vmn1r175 T C 7: 23,808,579 I208V possibly damaging Het
Other mutations in Papss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Papss1 APN 3 131599949 missense probably benign 0.00
IGL01642:Papss1 APN 3 131583235 splice site probably benign
IGL02249:Papss1 APN 3 131602011 missense probably damaging 1.00
IGL02832:Papss1 APN 3 131582519 missense probably damaging 1.00
IGL03008:Papss1 APN 3 131585099 missense possibly damaging 0.55
IGL03180:Papss1 APN 3 131607382 missense probably damaging 1.00
IGL03343:Papss1 APN 3 131583189 missense probably benign 0.27
IGL03384:Papss1 APN 3 131579352 missense probably damaging 0.96
R0549:Papss1 UTSW 3 131619213 missense possibly damaging 0.87
R0685:Papss1 UTSW 3 131583093 missense possibly damaging 0.61
R0800:Papss1 UTSW 3 131599854 splice site probably benign
R1225:Papss1 UTSW 3 131579301 splice site probably benign
R1458:Papss1 UTSW 3 131605854 missense probably damaging 1.00
R1718:Papss1 UTSW 3 131619185 missense probably damaging 1.00
R1728:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1784:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1862:Papss1 UTSW 3 131583184 missense possibly damaging 0.93
R1937:Papss1 UTSW 3 131599871 missense probably benign 0.38
R2349:Papss1 UTSW 3 131599866 missense probably benign
R3859:Papss1 UTSW 3 131607335 missense probably benign 0.30
R4698:Papss1 UTSW 3 131607331 missense probably damaging 0.97
R4741:Papss1 UTSW 3 131619099 missense probably damaging 1.00
R5642:Papss1 UTSW 3 131631804 nonsense probably null
R6658:Papss1 UTSW 3 131605935 missense probably benign
R6932:Papss1 UTSW 3 131599971 missense probably damaging 1.00
R7051:Papss1 UTSW 3 131602050 missense probably damaging 1.00
R7199:Papss1 UTSW 3 131585138 missense probably benign 0.01
R7201:Papss1 UTSW 3 131599926 missense probably damaging 1.00
R7276:Papss1 UTSW 3 131619234 missense probably benign 0.11
R7575:Papss1 UTSW 3 131643096 missense probably damaging 0.99
R7627:Papss1 UTSW 3 131585112 missense probably benign 0.01
R8325:Papss1 UTSW 3 131582611 missense probably benign
R8380:Papss1 UTSW 3 131631695 missense probably damaging 1.00
Z1088:Papss1 UTSW 3 131642967 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCTCAGTGACACATTAGACC -3'
(R):5'- AGGGAAACGGCCTGATTTCAG -3'

Sequencing Primer
(F):5'- GTGACACATTAGACCTAAGCGATGC -3'
(R):5'- ATTTCAGGAAGTGTGTCCAGTCAGAC -3'
Posted On2016-08-04