Incidental Mutation 'R5333:Stk31'
ID423345
Institutional Source Beutler Lab
Gene Symbol Stk31
Ensembl Gene ENSMUSG00000023403
Gene Nameserine threonine kinase 31
SynonymsC330007K24Rik
MMRRC Submission 042915-MU
Accession Numbers

Genbank: NM_029916; MGI: 1924735

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5333 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location49395604-49469501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49469152 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 930 (C930S)
Ref Sequence ENSEMBL: ENSMUSP00000127545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024171] [ENSMUST00000163954] [ENSMUST00000172459]
Predicted Effect probably benign
Transcript: ENSMUST00000024171
AA Change: C953S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024171
Gene: ENSMUSG00000023403
AA Change: C953S

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 768 932 4.6e-9 PFAM
Pfam:Pkinase 794 973 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163954
AA Change: C930S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127545
Gene: ENSMUSG00000023403
AA Change: C930S

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 784 922 7.4e-9 PFAM
Pfam:Pkinase 794 940 1.8e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000167846
AA Change: C301S
SMART Domains Protein: ENSMUSP00000130561
Gene: ENSMUSG00000023403
AA Change: C301S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 105 287 1e-6 PFAM
Pfam:Pkinase 184 284 1.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172459
AA Change: C908S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132896
Gene: ENSMUSG00000023403
AA Change: C908S

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 739 890 5.2e-9 PFAM
Pfam:Pkinase 749 917 1.1e-16 PFAM
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display normal embryonic development and spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,194,337 Y61N possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abca14 T A 7: 120,289,546 Y1238* probably null Het
Abcb5 A T 12: 118,867,942 V1225D probably damaging Het
Arhgef15 A G 11: 68,947,196 probably benign Het
As3mt A G 19: 46,708,196 R58G probably null Het
Asap1 T G 15: 64,127,414 N525T possibly damaging Het
Bhmt2 A G 13: 93,671,430 V50A probably benign Het
Ccdc180 A T 4: 45,890,935 I36F possibly damaging Het
Cd209c A G 8: 3,944,976 S63P probably damaging Het
Cdc37 T C 9: 21,143,161 E56G possibly damaging Het
Cdkal1 T C 13: 29,326,152 Y541C probably benign Het
Cenph G T 13: 100,761,772 H208N probably benign Het
Cfap65 A T 1: 74,903,175 L1740Q probably benign Het
Cfap74 A G 4: 155,436,740 D623G probably damaging Het
Ckap4 C A 10: 84,527,610 V530L probably damaging Het
Cldn13 A T 5: 134,915,015 N105K probably benign Het
Ddn T C 15: 98,805,356 D685G possibly damaging Het
Fam155a T A 8: 9,770,762 Q86L possibly damaging Het
Fdxr T C 11: 115,272,258 I70V probably benign Het
Fn1 A T 1: 71,624,180 Y1050N probably damaging Het
Impad1 A C 4: 4,767,963 V271G possibly damaging Het
Iqcf3 A G 9: 106,553,661 I96T possibly damaging Het
Itgax A G 7: 128,142,283 Y822C probably damaging Het
Katnb1 A T 8: 95,095,606 I286L possibly damaging Het
Lrp2 A C 2: 69,525,228 I424R probably benign Het
Lrpprc C A 17: 84,790,393 A41S probably benign Het
Mast3 A G 8: 70,783,501 L761P probably benign Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mpp4 C A 1: 59,157,441 R44L probably benign Het
Nkain3 T A 4: 20,484,889 M63L probably benign Het
Nup88 A C 11: 70,945,016 probably benign Het
Obscn A T 11: 59,062,692 C3837S probably damaging Het
Ogdh T G 11: 6,352,126 L850V probably damaging Het
Olfr1131 A G 2: 87,629,114 Y217C probably damaging Het
Olfr1293-ps A G 2: 111,527,703 I148V probably benign Het
Panx2 T C 15: 89,068,539 I411T possibly damaging Het
Papss1 T A 3: 131,643,044 M585K probably damaging Het
Pcbp2 T G 15: 102,486,021 L180R possibly damaging Het
Pcdha7 A T 18: 36,974,566 T215S probably benign Het
Pcdhga4 C T 18: 37,685,424 R9C probably benign Het
Plin4 A G 17: 56,104,970 V687A probably benign Het
Psma6 A G 12: 55,407,428 probably benign Het
Rcn1 A T 2: 105,389,126 S241T probably benign Het
Scgb2b18 A T 7: 33,173,275 L35H probably damaging Het
Slc11a1 A C 1: 74,384,145 D385A probably damaging Het
Syt10 T A 15: 89,841,729 Q14L probably benign Het
Tnxb T G 17: 34,690,231 W1578G probably damaging Het
Triml1 C T 8: 43,130,290 A425T possibly damaging Het
Vil1 G A 1: 74,432,390 V777I probably benign Het
Vmn1r175 T C 7: 23,808,579 I208V possibly damaging Het
Other mutations in Stk31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Stk31 APN 6 49437443 missense probably benign 0.41
IGL02479:Stk31 APN 6 49421688 missense probably damaging 0.99
IGL02490:Stk31 APN 6 49417535 missense probably benign 0.04
IGL03165:Stk31 APN 6 49445264 missense probably damaging 0.98
3-1:Stk31 UTSW 6 49417202 nonsense probably null
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0039:Stk31 UTSW 6 49442258 missense probably damaging 1.00
R0616:Stk31 UTSW 6 49423485 missense probably damaging 1.00
R0732:Stk31 UTSW 6 49417495 missense probably benign 0.00
R0975:Stk31 UTSW 6 49423409 missense probably damaging 1.00
R1127:Stk31 UTSW 6 49409207 missense probably damaging 1.00
R1705:Stk31 UTSW 6 49423384 missense possibly damaging 0.94
R1711:Stk31 UTSW 6 49469304 missense probably benign 0.10
R1892:Stk31 UTSW 6 49438474 missense probably damaging 1.00
R1942:Stk31 UTSW 6 49439127 missense probably damaging 0.98
R1953:Stk31 UTSW 6 49446478 critical splice donor site probably null
R2149:Stk31 UTSW 6 49439218 missense possibly damaging 0.80
R2281:Stk31 UTSW 6 49417250 missense probably damaging 1.00
R3438:Stk31 UTSW 6 49437521 missense probably benign 0.00
R4681:Stk31 UTSW 6 49437435 missense probably benign 0.37
R5492:Stk31 UTSW 6 49398243 missense probably damaging 1.00
R5782:Stk31 UTSW 6 49469136 missense probably benign 0.00
R5820:Stk31 UTSW 6 49417285 missense probably damaging 0.96
R5931:Stk31 UTSW 6 49469302 missense probably benign 0.05
R6012:Stk31 UTSW 6 49469309 missense probably damaging 0.96
R6254:Stk31 UTSW 6 49421697 missense probably benign 0.08
R6281:Stk31 UTSW 6 49469180 missense possibly damaging 0.93
R6294:Stk31 UTSW 6 49417344 missense probably benign 0.18
R6401:Stk31 UTSW 6 49423438 missense probably damaging 1.00
R7289:Stk31 UTSW 6 49438459 missense probably benign 0.05
R7490:Stk31 UTSW 6 49439232 critical splice donor site probably null
R7659:Stk31 UTSW 6 49423406 missense probably benign 0.00
Z1088:Stk31 UTSW 6 49417188 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGAGTCTCTGTCATTGTCATTACAG -3'
(R):5'- GATGCAATCCAACTAGTTCCAG -3'

Sequencing Primer
(F):5'- TCTCTGTCATTGTCATTACAGATTTG -3'
(R):5'- AGTCAAGGGTTGGCTTCACC -3'
Posted On2016-08-04