Incidental Mutation 'R5333:Psma6'
ID423365
Institutional Source Beutler Lab
Gene Symbol Psma6
Ensembl Gene ENSMUSG00000021024
Gene Nameproteasome (prosome, macropain) subunit, alpha type 6
Synonyms
MMRRC Submission 042915-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5333 (G1)
Quality Score222
Status Validated
Chromosome12
Chromosomal Location55384222-55418454 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 55407428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021412] [ENSMUST00000162711] [ENSMUST00000163070]
Predicted Effect probably benign
Transcript: ENSMUST00000021412
SMART Domains Protein: ENSMUSP00000021412
Gene: ENSMUSG00000021024

DomainStartEndE-ValueType
Proteasome_A_N 9 31 3.21e-9 SMART
Pfam:Proteasome 32 220 3.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162711
SMART Domains Protein: ENSMUSP00000123914
Gene: ENSMUSG00000021024

DomainStartEndE-ValueType
Pfam:Proteasome_A_N 9 25 4.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162972
Predicted Effect probably benign
Transcript: ENSMUST00000163070
SMART Domains Protein: ENSMUSP00000124781
Gene: ENSMUSG00000021024

DomainStartEndE-ValueType
Pfam:Proteasome 13 201 1.5e-56 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,194,337 Y61N possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abca14 T A 7: 120,289,546 Y1238* probably null Het
Abcb5 A T 12: 118,867,942 V1225D probably damaging Het
Arhgef15 A G 11: 68,947,196 probably benign Het
As3mt A G 19: 46,708,196 R58G probably null Het
Asap1 T G 15: 64,127,414 N525T possibly damaging Het
Bhmt2 A G 13: 93,671,430 V50A probably benign Het
Ccdc180 A T 4: 45,890,935 I36F possibly damaging Het
Cd209c A G 8: 3,944,976 S63P probably damaging Het
Cdc37 T C 9: 21,143,161 E56G possibly damaging Het
Cdkal1 T C 13: 29,326,152 Y541C probably benign Het
Cenph G T 13: 100,761,772 H208N probably benign Het
Cfap65 A T 1: 74,903,175 L1740Q probably benign Het
Cfap74 A G 4: 155,436,740 D623G probably damaging Het
Ckap4 C A 10: 84,527,610 V530L probably damaging Het
Cldn13 A T 5: 134,915,015 N105K probably benign Het
Ddn T C 15: 98,805,356 D685G possibly damaging Het
Fam155a T A 8: 9,770,762 Q86L possibly damaging Het
Fdxr T C 11: 115,272,258 I70V probably benign Het
Fn1 A T 1: 71,624,180 Y1050N probably damaging Het
Impad1 A C 4: 4,767,963 V271G possibly damaging Het
Iqcf3 A G 9: 106,553,661 I96T possibly damaging Het
Itgax A G 7: 128,142,283 Y822C probably damaging Het
Katnb1 A T 8: 95,095,606 I286L possibly damaging Het
Lrp2 A C 2: 69,525,228 I424R probably benign Het
Lrpprc C A 17: 84,790,393 A41S probably benign Het
Mast3 A G 8: 70,783,501 L761P probably benign Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mpp4 C A 1: 59,157,441 R44L probably benign Het
Nkain3 T A 4: 20,484,889 M63L probably benign Het
Nup88 A C 11: 70,945,016 probably benign Het
Obscn A T 11: 59,062,692 C3837S probably damaging Het
Ogdh T G 11: 6,352,126 L850V probably damaging Het
Olfr1131 A G 2: 87,629,114 Y217C probably damaging Het
Olfr1293-ps A G 2: 111,527,703 I148V probably benign Het
Panx2 T C 15: 89,068,539 I411T possibly damaging Het
Papss1 T A 3: 131,643,044 M585K probably damaging Het
Pcbp2 T G 15: 102,486,021 L180R possibly damaging Het
Pcdha7 A T 18: 36,974,566 T215S probably benign Het
Pcdhga4 C T 18: 37,685,424 R9C probably benign Het
Plin4 A G 17: 56,104,970 V687A probably benign Het
Rcn1 A T 2: 105,389,126 S241T probably benign Het
Scgb2b18 A T 7: 33,173,275 L35H probably damaging Het
Slc11a1 A C 1: 74,384,145 D385A probably damaging Het
Stk31 T A 6: 49,469,152 C930S probably benign Het
Syt10 T A 15: 89,841,729 Q14L probably benign Het
Tnxb T G 17: 34,690,231 W1578G probably damaging Het
Triml1 C T 8: 43,130,290 A425T possibly damaging Het
Vil1 G A 1: 74,432,390 V777I probably benign Het
Vmn1r175 T C 7: 23,808,579 I208V possibly damaging Het
Other mutations in Psma6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Psma6 APN 12 55407469 missense probably damaging 1.00
IGL02658:Psma6 APN 12 55412211 missense probably benign 0.07
IGL02991:Psma6 APN 12 55407572 splice site probably benign
R0761:Psma6 UTSW 12 55412342 missense possibly damaging 0.87
R1758:Psma6 UTSW 12 55407532 missense probably damaging 0.99
R2103:Psma6 UTSW 12 55408057 missense probably benign 0.23
R2897:Psma6 UTSW 12 55408044 missense probably benign 0.00
R5782:Psma6 UTSW 12 55410256 missense possibly damaging 0.68
R7432:Psma6 UTSW 12 55398828 intron probably benign
R8302:Psma6 UTSW 12 55410181 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAATTATCCCACCTTAGCCAGA -3'
(R):5'- TTTGATTTTGCAGCCATTGACTG -3'

Sequencing Primer
(F):5'- GAGCTACATAATGAGATCCTGGCTC -3'
(R):5'- ACTGGCTGGGCAGTATTACTTAC -3'
Posted On2016-08-04