Incidental Mutation 'R5334:Fbxo41'
ID423406
Institutional Source Beutler Lab
Gene Symbol Fbxo41
Ensembl Gene ENSMUSG00000047013
Gene NameF-box protein 41
SynonymsD6Ertd538e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R5334 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85469574-85502994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85478483 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 573 (V573A)
Ref Sequence ENSEMBL: ENSMUSP00000124754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]
Predicted Effect probably damaging
Transcript: ENSMUST00000159062
AA Change: V573A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: V573A

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161078
AA Change: V573A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: V573A

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161546
AA Change: V573A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: V573A

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ap4s1 C T 12: 51,738,671 S142L probably benign Het
Apol11a A G 15: 77,516,753 T147A probably benign Het
Aqp9 T C 9: 71,123,010 probably null Het
Arhgap25 T A 6: 87,463,261 N468I possibly damaging Het
Arhgef2 T A 3: 88,646,329 S924R probably damaging Het
Atad3a A T 4: 155,755,689 L144Q probably damaging Het
Ccbe1 T C 18: 66,083,245 I136V probably damaging Het
Col24a1 C A 3: 145,461,525 P1119Q possibly damaging Het
Dgkd T C 1: 87,938,267 probably null Het
Dnah7a A G 1: 53,503,646 I2455T probably benign Het
Dock2 T C 11: 34,228,643 T1795A probably benign Het
Dpp6 A T 5: 27,709,540 E541V probably benign Het
Edem1 T C 6: 108,848,832 probably null Het
Fech A C 18: 64,464,120 V256G probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gal3st4 T G 5: 138,265,721 K339Q probably benign Het
Gm11487 T A 4: 73,403,517 M94L probably benign Het
Gm884 T C 11: 103,613,873 Q2423R probably benign Het
Gpr158 T A 2: 21,827,505 S1139T probably benign Het
Gpr180 A T 14: 118,160,056 S321C probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Grin2c T G 11: 115,256,055 N438T possibly damaging Het
Hcn2 T C 10: 79,726,291 S374P probably damaging Het
Hmcn1 T A 1: 150,755,372 I892F probably damaging Het
Ifi207 C T 1: 173,727,531 V869I probably benign Het
Itgad T C 7: 128,189,286 Y390H probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj15 A G 16: 95,296,649 K377E probably damaging Het
Kcnq3 A G 15: 66,025,224 S276P probably damaging Het
Klhl26 T C 8: 70,452,318 D280G probably damaging Het
Lmnb2 C T 10: 80,903,957 V376I probably benign Het
Mepce T A 5: 137,786,627 R29S probably benign Het
Mlh3 A G 12: 85,245,761 probably null Het
Mlip T A 9: 77,243,676 T33S probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ncapg2 T C 12: 116,426,637 I402T probably damaging Het
Olfr1026 T C 2: 85,923,714 Y149H probably damaging Het
Olfr171 C G 16: 19,624,491 G203A probably benign Het
Pcsk5 T C 19: 17,461,851 D1301G probably benign Het
Pilrb1 T C 5: 137,854,903 M213V probably benign Het
Plxdc1 T C 11: 97,956,105 T163A possibly damaging Het
Pnpla2 T C 7: 141,459,493 L373P probably damaging Het
Prickle2 A G 6: 92,425,684 Y52H probably damaging Het
Rnf220 A G 4: 117,272,351 C294R probably damaging Het
Slc12a1 A G 2: 125,217,889 D903G probably damaging Het
Slc17a2 T C 13: 23,819,051 F228S probably damaging Het
Sptbn1 T C 11: 30,137,364 E1025G possibly damaging Het
Sult1c1 T G 17: 53,964,730 D143A probably damaging Het
Taar1 T G 10: 23,920,545 I47R probably damaging Het
Tctn3 G T 19: 40,602,822 Q514K probably benign Het
Tg T C 15: 66,678,055 F222S probably damaging Het
Tmem236 C A 2: 14,219,060 T220K possibly damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn1r237 T C 17: 21,314,680 F222L probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zfp85 T C 13: 67,751,684 Y52C probably damaging Het
Other mutations in Fbxo41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fbxo41 APN 6 85478102 splice site probably null
IGL00919:Fbxo41 APN 6 85478570 missense probably damaging 1.00
IGL01135:Fbxo41 APN 6 85477908 missense probably benign 0.41
IGL02084:Fbxo41 APN 6 85480765 critical splice donor site probably null
IGL02343:Fbxo41 APN 6 85478171 missense possibly damaging 0.78
IGL03284:Fbxo41 APN 6 85479765 missense probably damaging 1.00
R0116:Fbxo41 UTSW 6 85477908 missense probably damaging 1.00
R0452:Fbxo41 UTSW 6 85478182 missense probably damaging 1.00
R2064:Fbxo41 UTSW 6 85478471 nonsense probably null
R2065:Fbxo41 UTSW 6 85478471 nonsense probably null
R2067:Fbxo41 UTSW 6 85478471 nonsense probably null
R3433:Fbxo41 UTSW 6 85477631 missense probably damaging 1.00
R3522:Fbxo41 UTSW 6 85484181 missense probably benign 0.00
R4086:Fbxo41 UTSW 6 85478546 missense possibly damaging 0.93
R4520:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4521:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4522:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4523:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4524:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4867:Fbxo41 UTSW 6 85475194 missense probably benign
R4970:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5000:Fbxo41 UTSW 6 85483919 missense probably damaging 0.98
R5112:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5330:Fbxo41 UTSW 6 85479906 missense probably benign
R5331:Fbxo41 UTSW 6 85479906 missense probably benign
R5595:Fbxo41 UTSW 6 85479901 missense probably benign 0.00
R5632:Fbxo41 UTSW 6 85484504 missense probably damaging 1.00
R5698:Fbxo41 UTSW 6 85477656 missense possibly damaging 0.88
R5801:Fbxo41 UTSW 6 85484533 missense probably damaging 0.97
R5854:Fbxo41 UTSW 6 85475094 missense probably damaging 1.00
R6258:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6260:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6615:Fbxo41 UTSW 6 85478523 missense possibly damaging 0.60
R7061:Fbxo41 UTSW 6 85475466 missense probably benign 0.36
R7353:Fbxo41 UTSW 6 85479976 missense possibly damaging 0.71
R7681:Fbxo41 UTSW 6 85478479 nonsense probably null
R8077:Fbxo41 UTSW 6 85473229 missense probably damaging 0.98
R8801:Fbxo41 UTSW 6 85484681 missense probably damaging 1.00
X0024:Fbxo41 UTSW 6 85478470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTAGAGGTCTGAACTGGACTG -3'
(R):5'- TTCTCCAGCACGTCCTGAAG -3'

Sequencing Primer
(F):5'- AGGCACTGTGACAGCATCTTG -3'
(R):5'- TCCTGAAGGAGGCAGCG -3'
Posted On2016-08-04