Incidental Mutation 'R5334:Aqp9'
ID423416
Institutional Source Beutler Lab
Gene Symbol Aqp9
Ensembl Gene ENSMUSG00000032204
Gene Nameaquaporin 9
Synonyms1700020I22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5334 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location71110659-71168682 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 71123010 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060917] [ENSMUST00000060917] [ENSMUST00000074465] [ENSMUST00000074465] [ENSMUST00000113570] [ENSMUST00000113570] [ENSMUST00000113570] [ENSMUST00000113570] [ENSMUST00000144618] [ENSMUST00000144618]
Predicted Effect probably null
Transcript: ENSMUST00000060917
SMART Domains Protein: ENSMUSP00000050127
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:MIP 58 288 1.1e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060917
SMART Domains Protein: ENSMUSP00000050127
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:MIP 58 288 1.1e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074465
SMART Domains Protein: ENSMUSP00000074063
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074465
SMART Domains Protein: ENSMUSP00000074063
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113570
SMART Domains Protein: ENSMUSP00000109200
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113570
SMART Domains Protein: ENSMUSP00000109200
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113570
SMART Domains Protein: ENSMUSP00000109200
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113570
SMART Domains Protein: ENSMUSP00000109200
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144618
SMART Domains Protein: ENSMUSP00000116785
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 164 9.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144618
SMART Domains Protein: ENSMUSP00000116785
Gene: ENSMUSG00000032204

DomainStartEndE-ValueType
Pfam:MIP 17 164 9.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213527
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aquaglyceroporin subfamily of aquaporins. This protein transports water, glycerol, urea, purines and pyrimidines and plays a role in glycerol metabolism and osteoclast differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele have increased glycerol and triglyceride levels, increased resistance to glycerol-induced lysis, decreased glycerol permeability, and decreased susceptibility to the early stages of parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ap4s1 C T 12: 51,738,671 S142L probably benign Het
Apol11a A G 15: 77,516,753 T147A probably benign Het
Arhgap25 T A 6: 87,463,261 N468I possibly damaging Het
Arhgef2 T A 3: 88,646,329 S924R probably damaging Het
Atad3a A T 4: 155,755,689 L144Q probably damaging Het
Ccbe1 T C 18: 66,083,245 I136V probably damaging Het
Col24a1 C A 3: 145,461,525 P1119Q possibly damaging Het
Dgkd T C 1: 87,938,267 probably null Het
Dnah7a A G 1: 53,503,646 I2455T probably benign Het
Dock2 T C 11: 34,228,643 T1795A probably benign Het
Dpp6 A T 5: 27,709,540 E541V probably benign Het
Edem1 T C 6: 108,848,832 probably null Het
Fbxo41 A G 6: 85,478,483 V573A probably damaging Het
Fech A C 18: 64,464,120 V256G probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gal3st4 T G 5: 138,265,721 K339Q probably benign Het
Gm11487 T A 4: 73,403,517 M94L probably benign Het
Gm884 T C 11: 103,613,873 Q2423R probably benign Het
Gpr158 T A 2: 21,827,505 S1139T probably benign Het
Gpr180 A T 14: 118,160,056 S321C probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Grin2c T G 11: 115,256,055 N438T possibly damaging Het
Hcn2 T C 10: 79,726,291 S374P probably damaging Het
Hmcn1 T A 1: 150,755,372 I892F probably damaging Het
Ifi207 C T 1: 173,727,531 V869I probably benign Het
Itgad T C 7: 128,189,286 Y390H probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj15 A G 16: 95,296,649 K377E probably damaging Het
Kcnq3 A G 15: 66,025,224 S276P probably damaging Het
Klhl26 T C 8: 70,452,318 D280G probably damaging Het
Lmnb2 C T 10: 80,903,957 V376I probably benign Het
Mepce T A 5: 137,786,627 R29S probably benign Het
Mlh3 A G 12: 85,245,761 probably null Het
Mlip T A 9: 77,243,676 T33S probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ncapg2 T C 12: 116,426,637 I402T probably damaging Het
Olfr1026 T C 2: 85,923,714 Y149H probably damaging Het
Olfr171 C G 16: 19,624,491 G203A probably benign Het
Pcsk5 T C 19: 17,461,851 D1301G probably benign Het
Pilrb1 T C 5: 137,854,903 M213V probably benign Het
Plxdc1 T C 11: 97,956,105 T163A possibly damaging Het
Pnpla2 T C 7: 141,459,493 L373P probably damaging Het
Prickle2 A G 6: 92,425,684 Y52H probably damaging Het
Rnf220 A G 4: 117,272,351 C294R probably damaging Het
Slc12a1 A G 2: 125,217,889 D903G probably damaging Het
Slc17a2 T C 13: 23,819,051 F228S probably damaging Het
Sptbn1 T C 11: 30,137,364 E1025G possibly damaging Het
Sult1c1 T G 17: 53,964,730 D143A probably damaging Het
Taar1 T G 10: 23,920,545 I47R probably damaging Het
Tctn3 G T 19: 40,602,822 Q514K probably benign Het
Tg T C 15: 66,678,055 F222S probably damaging Het
Tmem236 C A 2: 14,219,060 T220K possibly damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn1r237 T C 17: 21,314,680 F222L probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zfp85 T C 13: 67,751,684 Y52C probably damaging Het
Other mutations in Aqp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Aqp9 APN 9 71132731 missense probably damaging 1.00
IGL01012:Aqp9 APN 9 71130549 splice site probably benign
IGL01667:Aqp9 APN 9 71138213 missense probably benign 0.13
IGL02225:Aqp9 APN 9 71130547 splice site probably benign
IGL02389:Aqp9 APN 9 71122906 missense possibly damaging 0.80
IGL02551:Aqp9 APN 9 71132640 missense probably damaging 0.98
IGL02904:Aqp9 APN 9 71138148 missense probably damaging 0.98
R0411:Aqp9 UTSW 9 71130444 missense probably benign 0.00
R0751:Aqp9 UTSW 9 71138205 missense probably damaging 1.00
R1656:Aqp9 UTSW 9 71138103 missense probably benign 0.01
R1731:Aqp9 UTSW 9 71122968 missense possibly damaging 0.91
R1733:Aqp9 UTSW 9 71112342 missense possibly damaging 0.67
R1865:Aqp9 UTSW 9 71112376 missense probably benign 0.29
R4058:Aqp9 UTSW 9 71130444 missense probably benign 0.00
R4756:Aqp9 UTSW 9 71163049 missense probably damaging 1.00
R4771:Aqp9 UTSW 9 71122870 missense probably damaging 1.00
R4904:Aqp9 UTSW 9 71162403 intron probably benign
R5511:Aqp9 UTSW 9 71163093 utr 5 prime probably benign
R5771:Aqp9 UTSW 9 71122864 missense probably damaging 1.00
R6329:Aqp9 UTSW 9 71132684 nonsense probably null
R6831:Aqp9 UTSW 9 71162420 intron probably benign
R6838:Aqp9 UTSW 9 71112216 missense probably benign 0.41
R7337:Aqp9 UTSW 9 71162482 missense probably benign 0.23
R7466:Aqp9 UTSW 9 71163261 splice site probably null
R7946:Aqp9 UTSW 9 71123008 missense probably damaging 1.00
R8316:Aqp9 UTSW 9 71138213 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTACGTGAAGACCTCAAATCCC -3'
(R):5'- ACGATCCTGTCAGTGTCTGC -3'

Sequencing Primer
(F):5'- TCCCCATCCTGCCAGAG -3'
(R):5'- GAACTCACTTTGTAGACCAGGCTG -3'
Posted On2016-08-04