Incidental Mutation 'R0487:Kndc1'
ID 42342
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 038686-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0487 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139493939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 507 (T507S)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
AlphaFold Q0KK55
Predicted Effect probably null
Transcript: ENSMUST00000053445
AA Change: T507S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: T507S

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121839
AA Change: T507S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: T507S

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,281,687 (GRCm39) M3190L probably benign Het
Adgrv1 A T 13: 81,637,154 (GRCm39) L3429H probably damaging Het
Ahnak A G 19: 8,991,484 (GRCm39) D4256G probably damaging Het
Ahnak A G 19: 8,984,515 (GRCm39) N1933S probably benign Het
Amacr A G 15: 10,984,835 (GRCm39) D151G probably benign Het
Ano9 A T 7: 140,687,762 (GRCm39) H255Q possibly damaging Het
Asphd2 A T 5: 112,539,501 (GRCm39) Y111N possibly damaging Het
Cage1 T A 13: 38,209,334 (GRCm39) K214N probably benign Het
Cdkn2c A G 4: 109,518,606 (GRCm39) L116P probably damaging Het
Cltc C T 11: 86,624,490 (GRCm39) R148H probably damaging Het
Cmbl A G 15: 31,582,176 (GRCm39) N58D probably damaging Het
Cpa6 T C 1: 10,479,487 (GRCm39) T249A possibly damaging Het
Cpsf1 T A 15: 76,481,202 (GRCm39) N1218I probably damaging Het
Csf2rb T C 15: 78,232,531 (GRCm39) S613P probably benign Het
Ctnnd1 A G 2: 84,439,411 (GRCm39) S761P probably damaging Het
Cxcr6 A C 9: 123,639,463 (GRCm39) I155L probably benign Het
Ecpas A G 4: 58,819,155 (GRCm39) V1265A probably damaging Het
Fam216a A G 5: 122,508,576 (GRCm39) probably null Het
Fgf10 T A 13: 118,918,147 (GRCm39) probably null Het
Fgf17 T C 14: 70,875,996 (GRCm39) T79A probably damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gm1527 G T 3: 28,980,828 (GRCm39) V643L probably benign Het
Hmcn2 A T 2: 31,276,689 (GRCm39) Q1556L possibly damaging Het
Hspa4l C T 3: 40,738,758 (GRCm39) T616I possibly damaging Het
Irag2 A G 6: 145,110,986 (GRCm39) S264G probably benign Het
Irgm1 T C 11: 48,757,154 (GRCm39) D219G probably damaging Het
Jcad A G 18: 4,673,243 (GRCm39) D335G probably damaging Het
Kcnh4 A G 11: 100,641,084 (GRCm39) F455S probably damaging Het
Khdrbs3 T C 15: 68,889,210 (GRCm39) Y120H probably damaging Het
Lepr G T 4: 101,625,290 (GRCm39) E482* probably null Het
Mcemp1 T A 8: 3,717,507 (GRCm39) M146K probably benign Het
Mllt10 A G 2: 18,211,948 (GRCm39) T411A probably damaging Het
Myh8 A T 11: 67,192,837 (GRCm39) I1543L probably benign Het
Myo1f T C 17: 33,797,258 (GRCm39) S147P probably damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Or5j1 C T 2: 86,878,837 (GRCm39) V248I probably damaging Het
Plaat1 G A 16: 29,039,331 (GRCm39) probably null Het
Plch2 G A 4: 155,093,469 (GRCm39) R57C probably damaging Het
Rbm20 G A 19: 53,839,626 (GRCm39) G872R probably damaging Het
Retsat A T 6: 72,583,414 (GRCm39) I373F probably damaging Het
Rnf145 T C 11: 44,446,056 (GRCm39) F297L probably benign Het
Ros1 A T 10: 52,031,204 (GRCm39) M479K possibly damaging Het
Rubcnl T A 14: 75,273,521 (GRCm39) N244K probably benign Het
Samhd1 A G 2: 156,952,535 (GRCm39) F406L probably damaging Het
Sdsl A T 5: 120,597,533 (GRCm39) V258D probably damaging Het
Sec24c C G 14: 20,733,467 (GRCm39) P166A probably benign Het
Sele C A 1: 163,881,184 (GRCm39) Y461* probably null Het
Slc22a1 G T 17: 12,881,487 (GRCm39) S334* probably null Het
Spem1 T G 11: 69,712,691 (GRCm39) probably null Het
Stat3 T C 11: 100,794,469 (GRCm39) E280G probably damaging Het
Stxbp4 T C 11: 90,483,186 (GRCm39) H280R probably benign Het
Tas2r129 G A 6: 132,928,906 (GRCm39) C281Y probably benign Het
Tas2r129 T G 6: 132,928,907 (GRCm39) C281W probably benign Het
Tcp11 T A 17: 28,298,897 (GRCm39) probably null Het
Tnrc6b G A 15: 80,764,876 (GRCm39) V793M probably benign Het
Vmn2r59 A C 7: 41,696,528 (GRCm39) Y71* probably null Het
Wdr35 T C 12: 9,062,743 (GRCm39) probably null Het
Zan A G 5: 137,411,620 (GRCm39) probably null Het
Zap70 G T 1: 36,818,365 (GRCm39) V351L probably damaging Het
Zfp609 G T 9: 65,609,916 (GRCm39) Q1016K unknown Het
Zfp641 C A 15: 98,187,060 (GRCm39) V188L probably benign Het
Zpld2 A T 4: 133,930,089 (GRCm39) L72Q probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCCAGGGGCAGAGCAATATGGAC -3'
(R):5'- AGACATCAGTGAACGCAGCTACAG -3'

Sequencing Primer
(F):5'- GGGTGATATACCCTAACAGTGTTCC -3'
(R):5'- TAGCCCCGCGAGTAAGATG -3'
Posted On 2013-05-23