Incidental Mutation 'R5334:Lmnb2'
ID 423420
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5334 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80737197-80754079 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80739791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 376 (V376I)
Ref Sequence ENSEMBL: ENSMUSP00000100969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000105333] [ENSMUST00000179022] [ENSMUST00000219896] [ENSMUST00000219817] [ENSMUST00000218481]
AlphaFold P21619
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057623
AA Change: V517I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: V517I

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105332
AA Change: V376I

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: V376I

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105333
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179022
AA Change: V498I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: V498I

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218149
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Predicted Effect probably benign
Transcript: ENSMUST00000219817
Predicted Effect probably benign
Transcript: ENSMUST00000218481
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Ap4s1 C T 12: 51,785,454 (GRCm39) S142L probably benign Het
Apol11a A G 15: 77,400,953 (GRCm39) T147A probably benign Het
Aqp9 T C 9: 71,030,292 (GRCm39) probably null Het
Arhgap25 T A 6: 87,440,243 (GRCm39) N468I possibly damaging Het
Arhgef2 T A 3: 88,553,636 (GRCm39) S924R probably damaging Het
Atad3a A T 4: 155,840,146 (GRCm39) L144Q probably damaging Het
Ccbe1 T C 18: 66,216,316 (GRCm39) I136V probably damaging Het
Col24a1 C A 3: 145,167,280 (GRCm39) P1119Q possibly damaging Het
Dgkd T C 1: 87,865,989 (GRCm39) probably null Het
Dnah7a A G 1: 53,542,805 (GRCm39) I2455T probably benign Het
Dock2 T C 11: 34,178,643 (GRCm39) T1795A probably benign Het
Dpp6 A T 5: 27,914,538 (GRCm39) E541V probably benign Het
Edem1 T C 6: 108,825,793 (GRCm39) probably null Het
Fbxo41 A G 6: 85,455,465 (GRCm39) V573A probably damaging Het
Fech A C 18: 64,597,191 (GRCm39) V256G probably damaging Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gal3st4 T G 5: 138,263,983 (GRCm39) K339Q probably benign Het
Gpr158 T A 2: 21,832,316 (GRCm39) S1139T probably benign Het
Gpr180 A T 14: 118,397,468 (GRCm39) S321C probably damaging Het
Grik1 CGG CGGG 16: 87,720,082 (GRCm39) probably null Het
Grin2c T G 11: 115,146,881 (GRCm39) N438T possibly damaging Het
Hcn2 T C 10: 79,562,125 (GRCm39) S374P probably damaging Het
Hmcn1 T A 1: 150,631,123 (GRCm39) I892F probably damaging Het
Ifi207 C T 1: 173,555,097 (GRCm39) V869I probably benign Het
Itgad T C 7: 127,788,458 (GRCm39) Y390H probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnj15 A G 16: 95,097,508 (GRCm39) K377E probably damaging Het
Kcnq3 A G 15: 65,897,073 (GRCm39) S276P probably damaging Het
Klhl26 T C 8: 70,904,968 (GRCm39) D280G probably damaging Het
Lrrc37 T C 11: 103,504,699 (GRCm39) Q2423R probably benign Het
Mepce T A 5: 137,784,889 (GRCm39) R29S probably benign Het
Mlh3 A G 12: 85,292,535 (GRCm39) probably null Het
Mlip T A 9: 77,150,958 (GRCm39) T33S probably damaging Het
Msantd5f6 T A 4: 73,321,754 (GRCm39) M94L probably benign Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Ncapg2 T C 12: 116,390,257 (GRCm39) I402T probably damaging Het
Or2aj6 C G 16: 19,443,241 (GRCm39) G203A probably benign Het
Or5m13b T C 2: 85,754,058 (GRCm39) Y149H probably damaging Het
Pcsk5 T C 19: 17,439,215 (GRCm39) D1301G probably benign Het
Pilrb1 T C 5: 137,853,165 (GRCm39) M213V probably benign Het
Plxdc1 T C 11: 97,846,931 (GRCm39) T163A possibly damaging Het
Pnpla2 T C 7: 141,039,406 (GRCm39) L373P probably damaging Het
Prickle2 A G 6: 92,402,665 (GRCm39) Y52H probably damaging Het
Rnf220 A G 4: 117,129,548 (GRCm39) C294R probably damaging Het
Slc12a1 A G 2: 125,059,809 (GRCm39) D903G probably damaging Het
Slc34a1 T C 13: 24,003,034 (GRCm39) F228S probably damaging Het
Sptbn1 T C 11: 30,087,364 (GRCm39) E1025G possibly damaging Het
Sult1c2 T G 17: 54,271,758 (GRCm39) D143A probably damaging Het
Taar1 T G 10: 23,796,443 (GRCm39) I47R probably damaging Het
Tctn3 G T 19: 40,591,266 (GRCm39) Q514K probably benign Het
Tg T C 15: 66,549,904 (GRCm39) F222S probably damaging Het
Tmem236 C A 2: 14,223,871 (GRCm39) T220K possibly damaging Het
Trim50 C T 5: 135,396,330 (GRCm39) T426M probably damaging Het
Vmn1r237 T C 17: 21,534,942 (GRCm39) F222L probably benign Het
Wrap73 G A 4: 154,229,731 (GRCm39) R34Q probably damaging Het
Zfp85 T C 13: 67,899,803 (GRCm39) Y52C probably damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80,739,871 (GRCm39) missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80,745,821 (GRCm39) missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80,740,818 (GRCm39) missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80,742,999 (GRCm39) missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80,742,088 (GRCm39) start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80,740,149 (GRCm39) unclassified probably benign
R1324:Lmnb2 UTSW 10 80,740,005 (GRCm39) missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80,743,025 (GRCm39) missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80,740,226 (GRCm39) unclassified probably benign
R5001:Lmnb2 UTSW 10 80,753,946 (GRCm39) missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80,740,489 (GRCm39) missense probably damaging 1.00
R5713:Lmnb2 UTSW 10 80,741,921 (GRCm39) missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80,740,962 (GRCm39) nonsense probably null
R6314:Lmnb2 UTSW 10 80,745,804 (GRCm39) missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80,745,794 (GRCm39) missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80,740,573 (GRCm39) missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80,753,991 (GRCm39) missense possibly damaging 0.52
R8230:Lmnb2 UTSW 10 80,740,982 (GRCm39) missense probably damaging 0.97
R8728:Lmnb2 UTSW 10 80,740,913 (GRCm39) critical splice donor site probably null
R9032:Lmnb2 UTSW 10 80,740,091 (GRCm39) missense probably benign 0.03
R9063:Lmnb2 UTSW 10 80,742,005 (GRCm39) missense probably benign 0.00
R9085:Lmnb2 UTSW 10 80,740,091 (GRCm39) missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80,739,072 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACACTGACAACTGTGAACTG -3'
(R):5'- GTTCGTGCGCCTTAAGAACTC -3'

Sequencing Primer
(F):5'- CTCAGACATGGGGAATCACTTG -3'
(R):5'- GCCTTAAGAACTCTTCAGACAAGGTG -3'
Posted On 2016-08-04