Incidental Mutation 'R5334:Lmnb2'
ID 423420
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5334 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80901203-80918245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80903957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 376 (V376I)
Ref Sequence ENSEMBL: ENSMUSP00000100969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000105333] [ENSMUST00000179022] [ENSMUST00000218481] [ENSMUST00000219817] [ENSMUST00000219896]
AlphaFold P21619
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057623
AA Change: V517I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: V517I

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105332
AA Change: V376I

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: V376I

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105333
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179022
AA Change: V498I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: V498I

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218149
Predicted Effect probably benign
Transcript: ENSMUST00000218481
Predicted Effect probably benign
Transcript: ENSMUST00000219817
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ap4s1 C T 12: 51,738,671 S142L probably benign Het
Apol11a A G 15: 77,516,753 T147A probably benign Het
Aqp9 T C 9: 71,123,010 probably null Het
Arhgap25 T A 6: 87,463,261 N468I possibly damaging Het
Arhgef2 T A 3: 88,646,329 S924R probably damaging Het
Atad3a A T 4: 155,755,689 L144Q probably damaging Het
Ccbe1 T C 18: 66,083,245 I136V probably damaging Het
Col24a1 C A 3: 145,461,525 P1119Q possibly damaging Het
Dgkd T C 1: 87,938,267 probably null Het
Dnah7a A G 1: 53,503,646 I2455T probably benign Het
Dock2 T C 11: 34,228,643 T1795A probably benign Het
Dpp6 A T 5: 27,709,540 E541V probably benign Het
Edem1 T C 6: 108,848,832 probably null Het
Fbxo41 A G 6: 85,478,483 V573A probably damaging Het
Fech A C 18: 64,464,120 V256G probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gal3st4 T G 5: 138,265,721 K339Q probably benign Het
Gm11487 T A 4: 73,403,517 M94L probably benign Het
Gm884 T C 11: 103,613,873 Q2423R probably benign Het
Gpr158 T A 2: 21,827,505 S1139T probably benign Het
Gpr180 A T 14: 118,160,056 S321C probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Grin2c T G 11: 115,256,055 N438T possibly damaging Het
Hcn2 T C 10: 79,726,291 S374P probably damaging Het
Hmcn1 T A 1: 150,755,372 I892F probably damaging Het
Ifi207 C T 1: 173,727,531 V869I probably benign Het
Itgad T C 7: 128,189,286 Y390H probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj15 A G 16: 95,296,649 K377E probably damaging Het
Kcnq3 A G 15: 66,025,224 S276P probably damaging Het
Klhl26 T C 8: 70,452,318 D280G probably damaging Het
Mepce T A 5: 137,786,627 R29S probably benign Het
Mlh3 A G 12: 85,245,761 probably null Het
Mlip T A 9: 77,243,676 T33S probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ncapg2 T C 12: 116,426,637 I402T probably damaging Het
Olfr1026 T C 2: 85,923,714 Y149H probably damaging Het
Olfr171 C G 16: 19,624,491 G203A probably benign Het
Pcsk5 T C 19: 17,461,851 D1301G probably benign Het
Pilrb1 T C 5: 137,854,903 M213V probably benign Het
Plxdc1 T C 11: 97,956,105 T163A possibly damaging Het
Pnpla2 T C 7: 141,459,493 L373P probably damaging Het
Prickle2 A G 6: 92,425,684 Y52H probably damaging Het
Rnf220 A G 4: 117,272,351 C294R probably damaging Het
Slc12a1 A G 2: 125,217,889 D903G probably damaging Het
Slc17a2 T C 13: 23,819,051 F228S probably damaging Het
Sptbn1 T C 11: 30,137,364 E1025G possibly damaging Het
Sult1c1 T G 17: 53,964,730 D143A probably damaging Het
Taar1 T G 10: 23,920,545 I47R probably damaging Het
Tctn3 G T 19: 40,602,822 Q514K probably benign Het
Tg T C 15: 66,678,055 F222S probably damaging Het
Tmem236 C A 2: 14,219,060 T220K possibly damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn1r237 T C 17: 21,314,680 F222L probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zfp85 T C 13: 67,751,684 Y52C probably damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1324:Lmnb2 UTSW 10 80904171 missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80904655 missense probably damaging 1.00
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80918157 missense possibly damaging 0.52
R8230:Lmnb2 UTSW 10 80905148 missense probably damaging 0.97
R8728:Lmnb2 UTSW 10 80905079 critical splice donor site probably null
R9032:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
R9063:Lmnb2 UTSW 10 80906171 missense probably benign 0.00
R9085:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACACTGACAACTGTGAACTG -3'
(R):5'- GTTCGTGCGCCTTAAGAACTC -3'

Sequencing Primer
(F):5'- CTCAGACATGGGGAATCACTTG -3'
(R):5'- GCCTTAAGAACTCTTCAGACAAGGTG -3'
Posted On 2016-08-04