Incidental Mutation 'R5334:Slc17a2'
ID423433
Institutional Source Beutler Lab
Gene Symbol Slc17a2
Ensembl Gene ENSMUSG00000036110
Gene Namesolute carrier family 17 (sodium phosphate), member 2
SynonymsNPT3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5334 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23806993-23825180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23819051 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 228 (F228S)
Ref Sequence ENSEMBL: ENSMUSP00000097288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
Predicted Effect probably damaging
Transcript: ENSMUST00000006786
AA Change: F228S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110
AA Change: F228S

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099697
AA Change: F228S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: F228S

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141717
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ap4s1 C T 12: 51,738,671 S142L probably benign Het
Apol11a A G 15: 77,516,753 T147A probably benign Het
Aqp9 T C 9: 71,123,010 probably null Het
Arhgap25 T A 6: 87,463,261 N468I possibly damaging Het
Arhgef2 T A 3: 88,646,329 S924R probably damaging Het
Atad3a A T 4: 155,755,689 L144Q probably damaging Het
Ccbe1 T C 18: 66,083,245 I136V probably damaging Het
Col24a1 C A 3: 145,461,525 P1119Q possibly damaging Het
Dgkd T C 1: 87,938,267 probably null Het
Dnah7a A G 1: 53,503,646 I2455T probably benign Het
Dock2 T C 11: 34,228,643 T1795A probably benign Het
Dpp6 A T 5: 27,709,540 E541V probably benign Het
Edem1 T C 6: 108,848,832 probably null Het
Fbxo41 A G 6: 85,478,483 V573A probably damaging Het
Fech A C 18: 64,464,120 V256G probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gal3st4 T G 5: 138,265,721 K339Q probably benign Het
Gm11487 T A 4: 73,403,517 M94L probably benign Het
Gm884 T C 11: 103,613,873 Q2423R probably benign Het
Gpr158 T A 2: 21,827,505 S1139T probably benign Het
Gpr180 A T 14: 118,160,056 S321C probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Grin2c T G 11: 115,256,055 N438T possibly damaging Het
Hcn2 T C 10: 79,726,291 S374P probably damaging Het
Hmcn1 T A 1: 150,755,372 I892F probably damaging Het
Ifi207 C T 1: 173,727,531 V869I probably benign Het
Itgad T C 7: 128,189,286 Y390H probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnj15 A G 16: 95,296,649 K377E probably damaging Het
Kcnq3 A G 15: 66,025,224 S276P probably damaging Het
Klhl26 T C 8: 70,452,318 D280G probably damaging Het
Lmnb2 C T 10: 80,903,957 V376I probably benign Het
Mepce T A 5: 137,786,627 R29S probably benign Het
Mlh3 A G 12: 85,245,761 probably null Het
Mlip T A 9: 77,243,676 T33S probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ncapg2 T C 12: 116,426,637 I402T probably damaging Het
Olfr1026 T C 2: 85,923,714 Y149H probably damaging Het
Olfr171 C G 16: 19,624,491 G203A probably benign Het
Pcsk5 T C 19: 17,461,851 D1301G probably benign Het
Pilrb1 T C 5: 137,854,903 M213V probably benign Het
Plxdc1 T C 11: 97,956,105 T163A possibly damaging Het
Pnpla2 T C 7: 141,459,493 L373P probably damaging Het
Prickle2 A G 6: 92,425,684 Y52H probably damaging Het
Rnf220 A G 4: 117,272,351 C294R probably damaging Het
Slc12a1 A G 2: 125,217,889 D903G probably damaging Het
Sptbn1 T C 11: 30,137,364 E1025G possibly damaging Het
Sult1c1 T G 17: 53,964,730 D143A probably damaging Het
Taar1 T G 10: 23,920,545 I47R probably damaging Het
Tctn3 G T 19: 40,602,822 Q514K probably benign Het
Tg T C 15: 66,678,055 F222S probably damaging Het
Tmem236 C A 2: 14,219,060 T220K possibly damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn1r237 T C 17: 21,314,680 F222L probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zfp85 T C 13: 67,751,684 Y52C probably damaging Het
Other mutations in Slc17a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc17a2 APN 13 23819334 missense probably benign 0.13
IGL01511:Slc17a2 APN 13 23819138 critical splice donor site probably null
IGL01624:Slc17a2 APN 13 23814986 missense probably benign 0.00
IGL01839:Slc17a2 APN 13 23812685 missense possibly damaging 0.91
IGL02010:Slc17a2 APN 13 23819042 missense probably benign 0.00
IGL03299:Slc17a2 APN 13 23821111 critical splice donor site probably null
R7808_slc17a2_962 UTSW 13 23819334 missense probably damaging 0.99
R0622:Slc17a2 UTSW 13 23812611 missense probably damaging 1.00
R1104:Slc17a2 UTSW 13 23819937 missense probably damaging 0.99
R1530:Slc17a2 UTSW 13 23819069 missense probably damaging 1.00
R1682:Slc17a2 UTSW 13 23812640 missense probably damaging 0.96
R2255:Slc17a2 UTSW 13 23821008 missense probably benign 0.09
R4923:Slc17a2 UTSW 13 23819095 missense probably benign 0.20
R5193:Slc17a2 UTSW 13 23819862 critical splice acceptor site probably null
R5321:Slc17a2 UTSW 13 23812631 missense possibly damaging 0.95
R5377:Slc17a2 UTSW 13 23812592 missense probably damaging 1.00
R6165:Slc17a2 UTSW 13 23815070 missense probably benign 0.00
R6280:Slc17a2 UTSW 13 23822394 missense probably benign
R6311:Slc17a2 UTSW 13 23815022 missense probably benign 0.40
R6323:Slc17a2 UTSW 13 23814986 missense probably benign 0.00
R6476:Slc17a2 UTSW 13 23812586 missense probably damaging 1.00
R6814:Slc17a2 UTSW 13 23822389 missense possibly damaging 0.55
R7155:Slc17a2 UTSW 13 23822407 missense probably benign 0.21
R7188:Slc17a2 UTSW 13 23822365 missense probably damaging 1.00
R7288:Slc17a2 UTSW 13 23819112 missense probably benign 0.09
R7462:Slc17a2 UTSW 13 23822418 missense probably damaging 1.00
R7808:Slc17a2 UTSW 13 23819334 missense probably damaging 0.99
R7937:Slc17a2 UTSW 13 23812665 missense probably benign
R8444:Slc17a2 UTSW 13 23819078 missense probably benign 0.00
R8447:Slc17a2 UTSW 13 23822326 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGGATTCTTAAGCCTTGGCTTC -3'
(R):5'- TTGGCATTATGATAGGTTACCCTAG -3'

Sequencing Primer
(F):5'- GTGAACTGGCATCTAAAAAGGTTC -3'
(R):5'- TTACCCTAGAAACAGAAAGTGCTCTG -3'
Posted On2016-08-04