Incidental Mutation 'R5335:Cachd1'
ID423464
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Namecache domain containing 1
SynonymsVwcd1, B430218L07Rik, 1190007F10Rik
MMRRC Submission 042916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R5335 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location100776675-101029220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100968085 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 579 (V579I)
Ref Sequence ENSEMBL: ENSMUSP00000030257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030257
AA Change: V579I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: V579I

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097955
AA Change: V579I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: V579I

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100966966 missense probably benign 0.05
IGL01531:Cachd1 APN 4 100953034 missense probably benign 0.02
IGL01705:Cachd1 APN 4 100983539 missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100992872 missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100974128 missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100952097 missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100968098 missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100952085 missense probably damaging 0.98
IGL03084:Cachd1 APN 4 101003088 missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100994737 missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100953205 missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100897703 missense probably damaging 0.99
R0578:Cachd1 UTSW 4 100994842 splice site probably benign
R0646:Cachd1 UTSW 4 100988221 missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100974876 missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100983301 splice site probably benign
R1156:Cachd1 UTSW 4 100988619 missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100974840 missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100974917 missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100988598 missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100966972 missense probably benign 0.02
R1774:Cachd1 UTSW 4 100964435 missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100967043 missense probably benign 0.02
R1845:Cachd1 UTSW 4 100777358 missense probably benign 0.01
R1869:Cachd1 UTSW 4 100983390 missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100953169 missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100990844 missense probably damaging 1.00
R2082:Cachd1 UTSW 4 101002958 missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100949069 splice site probably benign
R2517:Cachd1 UTSW 4 100980882 splice site probably null
R2896:Cachd1 UTSW 4 100970903 missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100974880 nonsense probably null
R3818:Cachd1 UTSW 4 100990865 missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100970888 missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100953130 nonsense probably null
R4791:Cachd1 UTSW 4 100918085 missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100994738 missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100964491 missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100966200 missense possibly damaging 0.94
R5322:Cachd1 UTSW 4 100952122 missense probably damaging 0.98
R5390:Cachd1 UTSW 4 100981006 missense probably damaging 1.00
R5573:Cachd1 UTSW 4 100974079 missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100865006 missense probably benign 0.31
R5905:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100952019 missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100981031 nonsense probably null
R6367:Cachd1 UTSW 4 101002970 missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100952118 missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100989486 missense probably benign
R6691:Cachd1 UTSW 4 100989486 missense probably benign
R7129:Cachd1 UTSW 4 100918066 missense probably null 0.99
R7187:Cachd1 UTSW 4 100976355 missense possibly damaging 0.95
R7387:Cachd1 UTSW 4 100777178 missense unknown
R7833:Cachd1 UTSW 4 100974815 missense probably benign 0.09
R7835:Cachd1 UTSW 4 100974153 splice site probably null
R7838:Cachd1 UTSW 4 100967014 missense possibly damaging 0.71
R7867:Cachd1 UTSW 4 100988562 missense probably damaging 0.97
R7882:Cachd1 UTSW 4 100967047 missense probably benign 0.29
R7941:Cachd1 UTSW 4 100988173 missense probably damaging 1.00
R7978:Cachd1 UTSW 4 100974863 missense probably damaging 1.00
R8085:Cachd1 UTSW 4 100988164 missense probably damaging 1.00
R8153:Cachd1 UTSW 4 100988638 critical splice donor site probably null
R8174:Cachd1 UTSW 4 100966269 missense probably damaging 0.99
R8219:Cachd1 UTSW 4 100990962 missense probably benign 0.34
R8358:Cachd1 UTSW 4 100959471 missense possibly damaging 0.94
R8376:Cachd1 UTSW 4 100974876 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCAGGGCTGACATAATGC -3'
(R):5'- TTAGTCACATTGGCTGGCCC -3'

Sequencing Primer
(F):5'- GCAGGGCTGACATAATGCTTTTAC -3'
(R):5'- ATTGGCTGGCCCGCATTC -3'
Posted On2016-08-04