Incidental Mutation 'R5335:Olfr601'
ID423473
Institutional Source Beutler Lab
Gene Symbol Olfr601
Ensembl Gene ENSMUSG00000109951
Gene Nameolfactory receptor 601
SynonymsGA_x6K02T2PBJ9-6068534-6067590, MOR24-3
MMRRC Submission 042916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5335 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103357094-103362655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103358522 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 224 (L224R)
Ref Sequence ENSEMBL: ENSMUSP00000150751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080474] [ENSMUST00000210431] [ENSMUST00000214110] [ENSMUST00000217416]
Predicted Effect probably damaging
Transcript: ENSMUST00000080474
AA Change: L224R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079328
Gene: ENSMUSG00000109951
AA Change: L224R

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6.6e-102 PFAM
Pfam:7TM_GPCR_Srsx 37 187 1.2e-10 PFAM
Pfam:7tm_1 43 294 2.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210431
AA Change: L224R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214110
AA Change: L224R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217416
AA Change: L224R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Olfr601
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02825:Olfr601 APN 7 103358361 missense probably benign 0.00
IGL03093:Olfr601 APN 7 103358239 utr 3 prime probably benign
R0147:Olfr601 UTSW 7 103358406 missense possibly damaging 0.67
R0436:Olfr601 UTSW 7 103358741 missense possibly damaging 0.69
R1486:Olfr601 UTSW 7 103358994 missense possibly damaging 0.93
R2943:Olfr601 UTSW 7 103358451 missense probably damaging 1.00
R4155:Olfr601 UTSW 7 103359156 missense probably benign 0.00
R5378:Olfr601 UTSW 7 103358445 missense probably damaging 1.00
R5840:Olfr601 UTSW 7 103358369 missense probably damaging 1.00
R6961:Olfr601 UTSW 7 103358582 missense possibly damaging 0.69
R7082:Olfr601 UTSW 7 103358288 missense possibly damaging 0.84
R7497:Olfr601 UTSW 7 103359012 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCAAGATCAGCTGCCTTTTAC -3'
(R):5'- ACACCCTGTCCTGCTTAAGC -3'

Sequencing Primer
(F):5'- GATCAGCTGCCTTTTACTTTTAGAG -3'
(R):5'- GCTTAAGCAGCTGCCCTACTG -3'
Posted On2016-08-04