Incidental Mutation 'R5335:Opcml'
ID423479
Institutional Source Beutler Lab
Gene Symbol Opcml
Ensembl Gene ENSMUSG00000062257
Gene Nameopioid binding protein/cell adhesion molecule-like
SynonymsObcam, B930023M13Rik, 2900075O15Rik, LOC235104
MMRRC Submission 042916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5335 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27790775-28925410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28675325 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000110898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073822] [ENSMUST00000115243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073822
AA Change: D120G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073493
Gene: ENSMUSG00000062257
AA Change: D120G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 42 133 2.94e-10 SMART
IGc2 148 209 2.91e-14 SMART
IGc2 235 303 2e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115243
AA Change: D113G

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110898
Gene: ENSMUSG00000062257
AA Change: D113G

DomainStartEndE-ValueType
IG 35 126 2.94e-10 SMART
IGc2 141 201 1.36e-14 SMART
IGc2 227 295 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126845
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Opcml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Opcml APN 9 28901590 missense probably damaging 1.00
IGL00864:Opcml APN 9 28901591 missense probably damaging 1.00
IGL00956:Opcml APN 9 28675328 missense possibly damaging 0.86
IGL02391:Opcml APN 9 28675264 missense probably damaging 0.96
IGL03210:Opcml APN 9 28901537 missense probably damaging 0.99
R0373:Opcml UTSW 9 28813398 missense possibly damaging 0.48
R1037:Opcml UTSW 9 28903299 missense probably damaging 1.00
R1564:Opcml UTSW 9 28903316 missense probably damaging 1.00
R2094:Opcml UTSW 9 28901590 missense probably damaging 1.00
R2268:Opcml UTSW 9 28903355 missense possibly damaging 0.91
R2426:Opcml UTSW 9 28903367 critical splice donor site probably null
R2938:Opcml UTSW 9 27791386 start codon destroyed probably null 0.00
R3746:Opcml UTSW 9 28901530 missense possibly damaging 0.54
R4058:Opcml UTSW 9 28901588 missense probably damaging 1.00
R4173:Opcml UTSW 9 28903358 missense probably benign
R4882:Opcml UTSW 9 28901590 missense probably damaging 1.00
R7058:Opcml UTSW 9 28675211 nonsense probably null
R7559:Opcml UTSW 9 28903324 missense probably benign
R8050:Opcml UTSW 9 28813344 missense probably damaging 0.97
R8250:Opcml UTSW 9 28675270 missense probably damaging 1.00
Z1177:Opcml UTSW 9 28404377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACCATAGATGATCGGGTCAC -3'
(R):5'- CCTGGTGAGAACAAAGTGCTAG -3'

Sequencing Primer
(F):5'- GTCACCCGGGTAGCCTG -3'
(R):5'- GAAGCTTTGAAATGCTCAACCTGTG -3'
Posted On2016-08-04