Incidental Mutation 'R5335:Gad1-ps'
ID423483
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Nameglutamate decarboxylase 1, pseudogene
SynonymsGad-1ps
MMRRC Submission 042916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5335 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99443838-99447029 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 99445147 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Meta Mutation Damage Score 0.2911 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99445448 exon noncoding transcript
IGL01301:Gad1-ps APN 10 99445151 exon noncoding transcript
IGL01394:Gad1-ps APN 10 99445562 exon noncoding transcript
IGL02220:Gad1-ps APN 10 99445322 exon noncoding transcript
IGL02240:Gad1-ps APN 10 99444958 exon noncoding transcript
IGL03406:Gad1-ps APN 10 99444779 exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99445151 exon noncoding transcript
R0305:Gad1-ps UTSW 10 99444803 exon noncoding transcript
R0446:Gad1-ps UTSW 10 99445521 exon noncoding transcript
R0538:Gad1-ps UTSW 10 99444992 exon noncoding transcript
R1511:Gad1-ps UTSW 10 99445469 exon noncoding transcript
R1734:Gad1-ps UTSW 10 99445775 exon noncoding transcript
R1745:Gad1-ps UTSW 10 99445524 exon noncoding transcript
R1886:Gad1-ps UTSW 10 99445582 exon noncoding transcript
R3111:Gad1-ps UTSW 10 99444521 exon noncoding transcript
R3617:Gad1-ps UTSW 10 99445398 exon noncoding transcript
R5042:Gad1-ps UTSW 10 99445654 exon noncoding transcript
R5223:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5234:Gad1-ps UTSW 10 99445326 exon noncoding transcript
R5275:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5295:Gad1-ps UTSW 10 99444889 exon noncoding transcript
R5334:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5336:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5337:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5396:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5397:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5399:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5428:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5429:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5431:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5661:Gad1-ps UTSW 10 99445039 exon noncoding transcript
R5667:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5671:Gad1-ps UTSW 10 99444533 exon noncoding transcript
R5885:Gad1-ps UTSW 10 99445147 exon noncoding transcript
R5886:Gad1-ps UTSW 10 99445147 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGCTTTGGAACAGACAATGTG -3'
(R):5'- AGAGGTAGCCTGCACACATC -3'

Sequencing Primer
(F):5'- GCTTTGGAACAGACAATGTGATTTTG -3'
(R):5'- ACATCTGGCTGCATCCTTGGAG -3'
Posted On2016-08-04