Mutagenetix > Incidental Mutations

Incidental Mutation 'R5335:Gad1-ps'

423483

Institutional Source

Beutler Lab

Gene Symbol

Gad1-ps

Ensembl Gene

ENSMUSG00000090665

Gene Name

glutamate decarboxylase 1, pseudogene

Synonyms

Gad-1ps

MMRRC Submission

042916-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R5335 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99443838-99447029 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

G to A at 99445147 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167243

SMART Domains

Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	1	368	4.3e-153	PFAM
Pfam:Beta_elim_lyase	91	436	7.3e-8	PFAM
Pfam:Aminotran_5	130	370	4.7e-7	PFAM

Meta Mutation Damage Score

0.2911

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (62/63)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010003K11Rik	A	G	19: 4,498,264	W86R	probably damaging	Het
Als2cr11b	T	A	1: 59,004,234		noncoding transcript	Het
Ankrd6	T	C	4: 32,818,651	E225G	probably damaging	Het
Armc4	A	T	18: 7,294,566	Y16N	probably benign	Het
Atxn10	A	G	15: 85,336,584		probably null	Het
Bcas2	A	G	3: 103,175,635	I146V	probably damaging	Het
Cachd1	G	A	4: 100,968,085	V579I	possibly damaging	Het
Col11a1	A	G	3: 114,095,240	T311A	unknown	Het
Cyp2c50	A	T	19: 40,090,616	L134F	probably benign	Het
Cyp2j11	T	C	4: 96,307,352	H369R	probably damaging	Het
Dis3	A	G	14: 99,097,653	V171A	possibly damaging	Het
Dnah12	A	G	14: 26,879,738	N3718D	probably damaging	Het
Dnah17	T	C	11: 118,112,514	I541V	probably damaging	Het
Eif3i	T	C	4: 129,595,186	D86G	probably benign	Het
Epc1	C	T	18: 6,490,689		probably benign	Het
Epc2	A	G	2: 49,513,230	N110S	probably benign	Het
Epha8	A	T	4: 136,931,935	L831Q	probably damaging	Het
Esd	G	T	14: 74,742,113	R119I	probably damaging	Het
F2	T	C	2: 91,634,932	K96E	possibly damaging	Het
Fcgbp	T	C	7: 28,089,734	V575A	probably damaging	Het
Gemin6	T	C	17: 80,225,755	V39A	probably damaging	Het
Glmp	G	T	3: 88,326,655		probably benign	Het
Gm10306	C	A	4: 94,556,807		probably benign	Het
Gm4846	A	T	1: 166,497,453	L23*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Grik1	CGG	CGGG	16: 87,923,194		probably null	Het
Ifi203	T	C	1: 173,926,919	T749A	possibly damaging	Het
Kcnip2	C	A	19: 45,794,246	A133S	probably benign	Het
Limch1	A	T	5: 66,881,957	I76F	probably damaging	Het
Mcph1	T	A	8: 18,689,061		probably null	Het
Myh7	A	G	14: 54,986,563		probably benign	Het
Olfr11	A	C	13: 21,638,779	V248G	probably damaging	Het
Olfr1106	T	G	2: 87,049,165	K24Q	probably damaging	Het
Olfr346	A	T	2: 36,688,094	I31F	probably benign	Het
Olfr54	A	C	11: 51,027,334	N111H	probably benign	Het
Olfr583	A	C	7: 103,051,535	D79A	probably damaging	Het
Olfr601	A	C	7: 103,358,522	L224R	probably damaging	Het
Olfr700	A	C	7: 106,805,734	S243A	probably damaging	Het
Opcml	A	G	9: 28,675,325	D113G	possibly damaging	Het
Pcdhb1	G	T	18: 37,267,255	C753F	probably benign	Het
Phip	T	C	9: 82,900,756	S879G	possibly damaging	Het
Pi4k2b	A	G	5: 52,741,756	D13G	possibly damaging	Het
Ptpn18	A	T	1: 34,463,178	I68F	probably damaging	Het
Rnf168	C	T	16: 32,298,584	T321I	possibly damaging	Het
Soga3	A	T	10: 29,147,106	I150L	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Srgap1	C	T	10: 121,785,377		probably benign	Het
Sry	A	T	Y: 2,663,647	H4Q	probably benign	Het
Taf2	G	A	15: 55,045,740	A703V	probably benign	Het
Taf5l	A	G	8: 124,003,651	F65L	probably damaging	Het
Tcp10b	T	C	17: 13,063,067		probably null	Het
Timm44	A	T	8: 4,266,814	I273N	probably damaging	Het
Tspan4	A	G	7: 141,489,615	T43A	probably damaging	Het
Ube2r2	T	C	4: 41,190,846		probably benign	Het
Urgcp	T	C	11: 5,717,754	T195A	possibly damaging	Het
Vmn1r197	T	C	13: 22,328,191	I94T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,807	I677K	probably damaging	Het
Zfp853	T	A	5: 143,288,563	H434L	unknown	Het

Other mutations in Gad1-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00963:Gad1-ps	APN	10	99445448	exon	noncoding transcript
IGL01301:Gad1-ps	APN	10	99445151	exon	noncoding transcript
IGL01394:Gad1-ps	APN	10	99445562	exon	noncoding transcript
IGL02220:Gad1-ps	APN	10	99445322	exon	noncoding transcript
IGL02240:Gad1-ps	APN	10	99444958	exon	noncoding transcript
IGL03406:Gad1-ps	APN	10	99444779	exon	noncoding transcript
ANU18:Gad1-ps	UTSW	10	99445151	exon	noncoding transcript
R0305:Gad1-ps	UTSW	10	99444803	exon	noncoding transcript
R0446:Gad1-ps	UTSW	10	99445521	exon	noncoding transcript
R0538:Gad1-ps	UTSW	10	99444992	exon	noncoding transcript
R1511:Gad1-ps	UTSW	10	99445469	exon	noncoding transcript
R1734:Gad1-ps	UTSW	10	99445775	exon	noncoding transcript
R1745:Gad1-ps	UTSW	10	99445524	exon	noncoding transcript
R1886:Gad1-ps	UTSW	10	99445582	exon	noncoding transcript
R3111:Gad1-ps	UTSW	10	99444521	exon	noncoding transcript
R3617:Gad1-ps	UTSW	10	99445398	exon	noncoding transcript
R5042:Gad1-ps	UTSW	10	99445654	exon	noncoding transcript
R5223:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5234:Gad1-ps	UTSW	10	99445326	exon	noncoding transcript
R5275:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5295:Gad1-ps	UTSW	10	99444889	exon	noncoding transcript
R5334:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5336:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5337:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5396:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5397:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5399:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5428:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5429:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5431:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5661:Gad1-ps	UTSW	10	99445039	exon	noncoding transcript
R5667:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5671:Gad1-ps	UTSW	10	99444533	exon	noncoding transcript
R5885:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript
R5886:Gad1-ps	UTSW	10	99445147	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGGCTTTGGAACAGACAATGTG -3'
(R):5'- AGAGGTAGCCTGCACACATC -3'

Sequencing Primer
(F):5'- GCTTTGGAACAGACAATGTGATTTTG -3'
(R):5'- ACATCTGGCTGCATCCTTGGAG -3'

Posted On

2016-08-04