Mutagenetix > Incidental Mutations

Incidental Mutation 'R5335:Taf2'

423494

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

042916-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5335 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55045740 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 703 (A703V)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

Predicted Effect

probably benign
Transcript: ENSMUST00000041733
AA Change: A703V

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: A703V

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226864

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227254

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228360

Meta Mutation Damage Score

0.1483

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010003K11Rik	A	G	19: 4,498,264	W86R	probably damaging	Het
Als2cr11b	T	A	1: 59,004,234		noncoding transcript	Het
Ankrd6	T	C	4: 32,818,651	E225G	probably damaging	Het
Armc4	A	T	18: 7,294,566	Y16N	probably benign	Het
Atxn10	A	G	15: 85,336,584		probably null	Het
Bcas2	A	G	3: 103,175,635	I146V	probably damaging	Het
Cachd1	G	A	4: 100,968,085	V579I	possibly damaging	Het
Col11a1	A	G	3: 114,095,240	T311A	unknown	Het
Cyp2c50	A	T	19: 40,090,616	L134F	probably benign	Het
Cyp2j11	T	C	4: 96,307,352	H369R	probably damaging	Het
Dis3	A	G	14: 99,097,653	V171A	possibly damaging	Het
Dnah12	A	G	14: 26,879,738	N3718D	probably damaging	Het
Dnah17	T	C	11: 118,112,514	I541V	probably damaging	Het
Eif3i	T	C	4: 129,595,186	D86G	probably benign	Het
Epc1	C	T	18: 6,490,689		probably benign	Het
Epc2	A	G	2: 49,513,230	N110S	probably benign	Het
Epha8	A	T	4: 136,931,935	L831Q	probably damaging	Het
Esd	G	T	14: 74,742,113	R119I	probably damaging	Het
F2	T	C	2: 91,634,932	K96E	possibly damaging	Het
Fcgbp	T	C	7: 28,089,734	V575A	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gemin6	T	C	17: 80,225,755	V39A	probably damaging	Het
Glmp	G	T	3: 88,326,655		probably benign	Het
Gm10306	C	A	4: 94,556,807		probably benign	Het
Gm4846	A	T	1: 166,497,453	L23*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Grik1	CGG	CGGG	16: 87,923,194		probably null	Het
Ifi203	T	C	1: 173,926,919	T749A	possibly damaging	Het
Kcnip2	C	A	19: 45,794,246	A133S	probably benign	Het
Limch1	A	T	5: 66,881,957	I76F	probably damaging	Het
Mcph1	T	A	8: 18,689,061		probably null	Het
Myh7	A	G	14: 54,986,563		probably benign	Het
Olfr11	A	C	13: 21,638,779	V248G	probably damaging	Het
Olfr1106	T	G	2: 87,049,165	K24Q	probably damaging	Het
Olfr346	A	T	2: 36,688,094	I31F	probably benign	Het
Olfr54	A	C	11: 51,027,334	N111H	probably benign	Het
Olfr583	A	C	7: 103,051,535	D79A	probably damaging	Het
Olfr601	A	C	7: 103,358,522	L224R	probably damaging	Het
Olfr700	A	C	7: 106,805,734	S243A	probably damaging	Het
Opcml	A	G	9: 28,675,325	D113G	possibly damaging	Het
Pcdhb1	G	T	18: 37,267,255	C753F	probably benign	Het
Phip	T	C	9: 82,900,756	S879G	possibly damaging	Het
Pi4k2b	A	G	5: 52,741,756	D13G	possibly damaging	Het
Ptpn18	A	T	1: 34,463,178	I68F	probably damaging	Het
Rnf168	C	T	16: 32,298,584	T321I	possibly damaging	Het
Soga3	A	T	10: 29,147,106	I150L	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Srgap1	C	T	10: 121,785,377		probably benign	Het
Sry	A	T	Y: 2,663,647	H4Q	probably benign	Het
Taf5l	A	G	8: 124,003,651	F65L	probably damaging	Het
Tcp10b	T	C	17: 13,063,067		probably null	Het
Timm44	A	T	8: 4,266,814	I273N	probably damaging	Het
Tspan4	A	G	7: 141,489,615	T43A	probably damaging	Het
Ube2r2	T	C	4: 41,190,846		probably benign	Het
Urgcp	T	C	11: 5,717,754	T195A	possibly damaging	Het
Vmn1r197	T	C	13: 22,328,191	I94T	probably damaging	Het
Vmn2r15	A	T	5: 109,286,807	I677K	probably damaging	Het
Zfp853	T	A	5: 143,288,563	H434L	unknown	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAAGAATTCTCCTCCATTTTCAG -3'
(R):5'- TAGACCCAGATATGTCCGTCC -3'

Sequencing Primer
(F):5'- CCTCCATTTTCAGTTTGACAATAATG -3'
(R):5'- CCAGATATGTCCGTCCTGAGGAAG -3'

Posted On

2016-08-04