Incidental Mutation 'R5335:Taf2'
ID 423494
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene Name TATA-box binding protein associated factor 2
Synonyms CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150
MMRRC Submission 042916-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5335 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 55015131-55072152 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55045740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 703 (A703V)
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041733]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041733
AA Change: A703V

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: A703V

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228360
Meta Mutation Damage Score 0.1483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 55071449 critical splice acceptor site probably null
IGL00475:Taf2 APN 15 55055850 nonsense probably null
IGL00549:Taf2 APN 15 55031115 missense probably benign 0.03
IGL00839:Taf2 APN 15 55045778 nonsense probably null
IGL01089:Taf2 APN 15 55016581 missense probably benign
IGL01305:Taf2 APN 15 55048274 missense probably damaging 0.99
IGL01532:Taf2 APN 15 55049486 missense possibly damaging 0.94
IGL01903:Taf2 APN 15 55060016 missense probably benign 0.03
IGL02324:Taf2 APN 15 55028376 missense probably benign
IGL02328:Taf2 APN 15 55028376 missense probably benign
IGL02405:Taf2 APN 15 55034155 splice site probably benign
IGL02671:Taf2 APN 15 55034176 missense probably benign 0.01
IGL02832:Taf2 APN 15 55016563 missense probably benign 0.01
IGL03105:Taf2 APN 15 55045799 missense probably benign 0.26
IGL03118:Taf2 APN 15 55052163 missense probably damaging 1.00
ANU22:Taf2 UTSW 15 55048274 missense probably damaging 0.99
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0183:Taf2 UTSW 15 55055790 missense possibly damaging 0.89
R0326:Taf2 UTSW 15 55047460 missense probably damaging 0.97
R0362:Taf2 UTSW 15 55045929 missense probably damaging 1.00
R0423:Taf2 UTSW 15 55064682 missense probably benign 0.02
R0562:Taf2 UTSW 15 55022188 splice site probably benign
R0609:Taf2 UTSW 15 55060050 missense probably damaging 1.00
R0655:Taf2 UTSW 15 55038294 missense probably damaging 1.00
R0689:Taf2 UTSW 15 55063065 missense possibly damaging 0.60
R0743:Taf2 UTSW 15 55016461 small deletion probably benign
R0898:Taf2 UTSW 15 55060084 missense probably damaging 0.97
R0969:Taf2 UTSW 15 55031157 critical splice acceptor site probably null
R0974:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1160:Taf2 UTSW 15 55071397 missense probably benign 0.01
R1376:Taf2 UTSW 15 55016461 small deletion probably benign
R1388:Taf2 UTSW 15 55036625 missense probably benign 0.00
R1416:Taf2 UTSW 15 55038410 missense possibly damaging 0.95
R1458:Taf2 UTSW 15 55059915 missense probably damaging 0.99
R1477:Taf2 UTSW 15 55062172 missense possibly damaging 0.87
R1755:Taf2 UTSW 15 55016454 missense probably damaging 1.00
R1766:Taf2 UTSW 15 55071397 missense probably benign 0.01
R2090:Taf2 UTSW 15 55016486 missense probably damaging 0.99
R2228:Taf2 UTSW 15 55064646 missense possibly damaging 0.94
R2519:Taf2 UTSW 15 55052247 missense probably benign 0.03
R4073:Taf2 UTSW 15 55052237 missense probably damaging 1.00
R4470:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4471:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4472:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4716:Taf2 UTSW 15 55065968 missense probably benign 0.02
R4937:Taf2 UTSW 15 55027223 nonsense probably null
R5082:Taf2 UTSW 15 55060045 missense probably benign 0.41
R5383:Taf2 UTSW 15 55049419 missense possibly damaging 0.78
R5771:Taf2 UTSW 15 55059939 missense probably benign 0.01
R5862:Taf2 UTSW 15 55048323 missense possibly damaging 0.95
R5873:Taf2 UTSW 15 55038422 missense probably benign 0.00
R5908:Taf2 UTSW 15 55072006 unclassified probably benign
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6159:Taf2 UTSW 15 55063044 missense possibly damaging 0.48
R6568:Taf2 UTSW 15 55064630 missense probably damaging 1.00
R7094:Taf2 UTSW 15 55060086 missense probably benign 0.27
R7174:Taf2 UTSW 15 55048739 missense possibly damaging 0.51
R7241:Taf2 UTSW 15 55062141 missense probably benign 0.01
R7561:Taf2 UTSW 15 55055833 missense probably benign 0.16
R7583:Taf2 UTSW 15 55064676 nonsense probably null
R7818:Taf2 UTSW 15 55065930 missense probably benign
R7905:Taf2 UTSW 15 55047432 missense possibly damaging 0.90
R8006:Taf2 UTSW 15 55048701 missense probably damaging 1.00
R8017:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8019:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8119:Taf2 UTSW 15 55031130 missense probably benign 0.00
R8127:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8128:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8129:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8278:Taf2 UTSW 15 55065965 nonsense probably null
R8290:Taf2 UTSW 15 55063020 missense probably damaging 1.00
R8762:Taf2 UTSW 15 55047453 missense probably benign 0.16
R8832:Taf2 UTSW 15 55064605 missense possibly damaging 0.86
R8916:Taf2 UTSW 15 55036535 missense probably benign 0.26
R8937:Taf2 UTSW 15 55047453 missense probably benign 0.16
R9006:Taf2 UTSW 15 55045905 missense possibly damaging 0.94
R9138:Taf2 UTSW 15 55016461 small deletion probably benign
R9240:Taf2 UTSW 15 55063068 missense probably null 1.00
R9257:Taf2 UTSW 15 55066013 missense possibly damaging 0.46
R9485:Taf2 UTSW 15 55048271 missense probably benign 0.05
R9762:Taf2 UTSW 15 55031044 critical splice donor site probably null
R9766:Taf2 UTSW 15 55047485 critical splice acceptor site probably null
R9796:Taf2 UTSW 15 55047436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAAGAATTCTCCTCCATTTTCAG -3'
(R):5'- TAGACCCAGATATGTCCGTCC -3'

Sequencing Primer
(F):5'- CCTCCATTTTCAGTTTGACAATAATG -3'
(R):5'- CCAGATATGTCCGTCCTGAGGAAG -3'
Posted On 2016-08-04