Incidental Mutation 'R5335:Armc4'
ID423500
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission 042916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5335 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7294566 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 16 (Y16N)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably benign
Transcript: ENSMUST00000081275
AA Change: Y16N

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: Y16N

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1677:Armc4 UTSW 18 7222554 missense probably benign 0.01
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2206:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R3422:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5434:Armc4 UTSW 18 7222550 missense probably benign 0.03
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5848:Armc4 UTSW 18 7268507 synonymous probably null
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6968:Armc4 UTSW 18 7273155 splice site probably null
R6974:Armc4 UTSW 18 7294479 missense probably benign 0.37
R7024:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7299:Armc4 UTSW 18 7222635 missense probably damaging 1.00
R7578:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7737:Armc4 UTSW 18 7217890 missense probably damaging 1.00
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGCTTACCTGACAACATAAC -3'
(R):5'- TGGAAATCTCCTCAAACAACTCTG -3'

Sequencing Primer
(F):5'- CCTAATTCAAATGCTGAGGGTTCC -3'
(R):5'- AACAACTCTGTTTTATGTGGTGATGC -3'
Posted On2016-08-04