Incidental Mutation 'R5335:Gm7102'
ID423505
Institutional Source Beutler Lab
Gene Symbol Gm7102
Ensembl Gene ENSMUSG00000094649
Gene Namepredicted gene 7102
Synonyms
MMRRC Submission 042916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5335 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location61174686-61176309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61175926 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 24 (G24R)
Ref Sequence ENSEMBL: ENSMUSP00000137574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180168]
Predicted Effect unknown
Transcript: ENSMUST00000180168
AA Change: G24R
SMART Domains Protein: ENSMUSP00000137574
Gene: ENSMUSG00000094649
AA Change: G24R

DomainStartEndE-ValueType
Pfam:MPLKIP 31 170 8.9e-27 PFAM
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Gm7102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Gm7102 APN 19 61175761 missense probably damaging 0.98
IGL02958:Gm7102 APN 19 61175680 missense possibly damaging 0.83
R0427:Gm7102 UTSW 19 61175470 missense probably damaging 1.00
R1886:Gm7102 UTSW 19 61175698 missense probably damaging 0.97
R4576:Gm7102 UTSW 19 61175926 missense unknown
R4578:Gm7102 UTSW 19 61175926 missense unknown
R4615:Gm7102 UTSW 19 61175926 missense unknown
R4616:Gm7102 UTSW 19 61175926 missense unknown
R4617:Gm7102 UTSW 19 61175926 missense unknown
R4621:Gm7102 UTSW 19 61175926 missense unknown
R4622:Gm7102 UTSW 19 61175926 missense unknown
R4623:Gm7102 UTSW 19 61175926 missense unknown
R4826:Gm7102 UTSW 19 61175926 missense unknown
R4827:Gm7102 UTSW 19 61175926 missense unknown
R4829:Gm7102 UTSW 19 61175926 missense unknown
R4830:Gm7102 UTSW 19 61175926 missense unknown
R4870:Gm7102 UTSW 19 61175926 missense unknown
R4871:Gm7102 UTSW 19 61175926 missense unknown
R4951:Gm7102 UTSW 19 61175926 missense unknown
R5112:Gm7102 UTSW 19 61175926 missense unknown
R5301:Gm7102 UTSW 19 61175926 missense unknown
R5317:Gm7102 UTSW 19 61175926 missense unknown
R5397:Gm7102 UTSW 19 61175926 missense unknown
R5399:Gm7102 UTSW 19 61175926 missense unknown
R5591:Gm7102 UTSW 19 61175926 missense unknown
R5592:Gm7102 UTSW 19 61175926 missense unknown
R5594:Gm7102 UTSW 19 61175926 missense unknown
R5616:Gm7102 UTSW 19 61175926 missense unknown
R5884:Gm7102 UTSW 19 61175926 missense unknown
R5919:Gm7102 UTSW 19 61175469 missense probably damaging 1.00
R7003:Gm7102 UTSW 19 61175881 missense possibly damaging 0.93
R7112:Gm7102 UTSW 19 61175559 missense probably damaging 1.00
R7266:Gm7102 UTSW 19 61175535 missense possibly damaging 0.84
Z1177:Gm7102 UTSW 19 61175750 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCCGAACTGATGCTG -3'
(R):5'- GCAGTTGATCGCTGAGGTTC -3'

Sequencing Primer
(F):5'- AACTGATGCTGGGACCCC -3'
(R):5'- AGGTTCGGCAGTTGAGGC -3'
Posted On2016-08-04