Incidental Mutation 'R5336:Olfr403'
ID423532
Institutional Source Beutler Lab
Gene Symbol Olfr403
Ensembl Gene ENSMUSG00000070378
Gene Nameolfactory receptor 403
SynonymsMOR125-5_p, IA7, GA_x6K02T2P1NL-4348188-4349129
MMRRC Submission 042844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5336 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74186249-74198612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74196033 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 177 (F177L)
Ref Sequence ENSEMBL: ENSMUSP00000145741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076675] [ENSMUST00000206114]
Predicted Effect probably damaging
Transcript: ENSMUST00000076675
AA Change: F177L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075971
Gene: ENSMUSG00000070378
AA Change: F177L

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.3e-59 PFAM
Pfam:7tm_1 41 238 7.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206114
AA Change: F177L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206247
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,499 E289D probably damaging Het
Acyp1 A T 12: 85,280,011 F80I probably damaging Het
Anapc5 T C 5: 122,807,337 N226S probably damaging Het
Ankhd1 T A 18: 36,646,716 S1704T probably damaging Het
Btnl5-ps T C 17: 34,492,397 noncoding transcript Het
Cacna1h T C 17: 25,392,231 H531R probably damaging Het
Chpf C A 1: 75,475,707 A368S possibly damaging Het
Cntn4 T C 6: 106,662,634 V575A possibly damaging Het
Col5a3 A T 9: 20,799,301 F551I unknown Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dcxr A G 11: 120,727,176 probably null Het
Ddost T C 4: 138,309,430 Y147H possibly damaging Het
Eif2ak2 A G 17: 78,874,043 F92L probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
H2-T23 T A 17: 36,031,658 N196I possibly damaging Het
Ighv9-2 A C 12: 114,109,285 F23V probably benign Het
Igsf10 T C 3: 59,320,132 E2040G probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myh4 A G 11: 67,259,191 probably null Het
Nlrp2 T C 7: 5,328,119 D426G probably benign Het
Otof T C 5: 30,376,720 D1415G probably benign Het
Ppig T C 2: 69,750,224 S701P unknown Het
Ptprf A G 4: 118,235,634 I528T probably damaging Het
Scara3 A G 14: 65,931,038 Y377H probably damaging Het
Slf1 A T 13: 77,106,010 *176R probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tarm1 T C 7: 3,497,568 Y61C probably damaging Het
Tle4 A G 19: 14,454,739 probably null Het
Tlr1 A T 5: 64,925,802 N477K probably damaging Het
Tns2 C T 15: 102,111,229 T518M probably damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn2r85 T C 10: 130,422,705 I494V possibly damaging Het
Wdr17 T A 8: 54,632,318 I1257F probably damaging Het
Zfp874a T C 13: 67,442,680 H295R probably damaging Het
Other mutations in Olfr403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Olfr403 APN 11 74195761 missense probably damaging 1.00
IGL01716:Olfr403 APN 11 74196381 missense probably benign 0.01
R0598:Olfr403 UTSW 11 74195832 missense possibly damaging 0.90
R1168:Olfr403 UTSW 11 74196421 missense probably benign
R1440:Olfr403 UTSW 11 74195679 missense probably damaging 1.00
R1657:Olfr403 UTSW 11 74195896 missense probably damaging 0.98
R1834:Olfr403 UTSW 11 74195653 missense probably benign 0.00
R1990:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R1991:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R2206:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R2207:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R3103:Olfr403 UTSW 11 74196075 missense probably benign 0.39
R4662:Olfr403 UTSW 11 74195716 missense probably damaging 1.00
R4844:Olfr403 UTSW 11 74196076 missense probably damaging 0.98
R5918:Olfr403 UTSW 11 74196118 missense probably damaging 0.96
R6858:Olfr403 UTSW 11 74196099 missense probably benign 0.01
R7175:Olfr403 UTSW 11 74196178 nonsense probably null
R7362:Olfr403 UTSW 11 74195586 missense probably benign 0.01
R7670:Olfr403 UTSW 11 74196207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCATATGACCGAGCTGTG -3'
(R):5'- GCCCATGACTGTCCCATAATAC -3'

Sequencing Primer
(F):5'- TGTGGCTATCAGTCGCCC -3'
(R):5'- ACAGGTGGACAAGGCCTTC -3'
Posted On2016-08-04