Incidental Mutation 'R5336:Acyp1'
ID423534
Institutional Source Beutler Lab
Gene Symbol Acyp1
Ensembl Gene ENSMUSG00000008822
Gene Nameacylphosphatase 1, erythrocyte (common) type
Synonyms
MMRRC Submission 042844-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R5336 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85272398-85288438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85280011 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 80 (F80I)
Ref Sequence ENSEMBL: ENSMUSP00000112609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000065913] [ENSMUST00000117138] [ENSMUST00000121930]
Predicted Effect probably damaging
Transcript: ENSMUST00000008966
AA Change: F22I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822
AA Change: F22I

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000065913
AA Change: F22I
SMART Domains Protein: ENSMUSP00000070555
Gene: ENSMUSG00000008822
AA Change: F22I

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 35 5.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117138
AA Change: F22I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822
AA Change: F22I

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121930
AA Change: F80I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822
AA Change: F80I

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,499 E289D probably damaging Het
Anapc5 T C 5: 122,807,337 N226S probably damaging Het
Ankhd1 T A 18: 36,646,716 S1704T probably damaging Het
Btnl5-ps T C 17: 34,492,397 noncoding transcript Het
Cacna1h T C 17: 25,392,231 H531R probably damaging Het
Chpf C A 1: 75,475,707 A368S possibly damaging Het
Cntn4 T C 6: 106,662,634 V575A possibly damaging Het
Col5a3 A T 9: 20,799,301 F551I unknown Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dcxr A G 11: 120,727,176 probably null Het
Ddost T C 4: 138,309,430 Y147H possibly damaging Het
Eif2ak2 A G 17: 78,874,043 F92L probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
H2-T23 T A 17: 36,031,658 N196I possibly damaging Het
Ighv9-2 A C 12: 114,109,285 F23V probably benign Het
Igsf10 T C 3: 59,320,132 E2040G probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myh4 A G 11: 67,259,191 probably null Het
Nlrp2 T C 7: 5,328,119 D426G probably benign Het
Olfr403 T C 11: 74,196,033 F177L probably damaging Het
Otof T C 5: 30,376,720 D1415G probably benign Het
Ppig T C 2: 69,750,224 S701P unknown Het
Ptprf A G 4: 118,235,634 I528T probably damaging Het
Scara3 A G 14: 65,931,038 Y377H probably damaging Het
Slf1 A T 13: 77,106,010 *176R probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tarm1 T C 7: 3,497,568 Y61C probably damaging Het
Tle4 A G 19: 14,454,739 probably null Het
Tlr1 A T 5: 64,925,802 N477K probably damaging Het
Tns2 C T 15: 102,111,229 T518M probably damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn2r85 T C 10: 130,422,705 I494V possibly damaging Het
Wdr17 T A 8: 54,632,318 I1257F probably damaging Het
Zfp874a T C 13: 67,442,680 H295R probably damaging Het
Other mutations in Acyp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1204:Acyp1 UTSW 12 85280092 splice site probably null
R1898:Acyp1 UTSW 12 85288340 missense probably benign 0.00
R4683:Acyp1 UTSW 12 85278943 intron probably benign
R5392:Acyp1 UTSW 12 85278985 intron probably benign
R6747:Acyp1 UTSW 12 85278905 missense probably null
R7075:Acyp1 UTSW 12 85279008 missense unknown
R7746:Acyp1 UTSW 12 85279058 missense unknown
R7794:Acyp1 UTSW 12 85288279 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTCTCTATCTTGATGGCAGC -3'
(R):5'- AGGGGCTTGCGTTTACATCC -3'

Sequencing Primer
(F):5'- CAGCTTTTTAGAGGCGACTTAGC -3'
(R):5'- GGGCTTGCGTTTACATCCACTTAC -3'
Posted On2016-08-04