Incidental Mutation 'R5336:Tle4'
ID423545
Institutional Source Beutler Lab
Gene Symbol Tle4
Ensembl Gene ENSMUSG00000024642
Gene Nametransducin-like enhancer of split 4
SynonymsBce1, ESTM14, 5730411M05Rik, Grg4, ESTM13
MMRRC Submission 042844-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5336 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location14448072-14598051 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 14454739 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052011] [ENSMUST00000167776]
Predicted Effect probably null
Transcript: ENSMUST00000052011
SMART Domains Protein: ENSMUSP00000057527
Gene: ENSMUSG00000024642

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 9.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167776
SMART Domains Protein: ENSMUSP00000126249
Gene: ENSMUSG00000024642

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 5.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 199 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are runted and die around 4 weeks of age with leukocytopenia, B cell lymphopenia, reduced bone mineralization and reduced hematopoietic stem cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,224,499 E289D probably damaging Het
Acyp1 A T 12: 85,280,011 F80I probably damaging Het
Anapc5 T C 5: 122,807,337 N226S probably damaging Het
Ankhd1 T A 18: 36,646,716 S1704T probably damaging Het
Btnl5-ps T C 17: 34,492,397 noncoding transcript Het
Cacna1h T C 17: 25,392,231 H531R probably damaging Het
Chpf C A 1: 75,475,707 A368S possibly damaging Het
Cntn4 T C 6: 106,662,634 V575A possibly damaging Het
Col5a3 A T 9: 20,799,301 F551I unknown Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dcxr A G 11: 120,727,176 probably null Het
Ddost T C 4: 138,309,430 Y147H possibly damaging Het
Eif2ak2 A G 17: 78,874,043 F92L probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
H2-T23 T A 17: 36,031,658 N196I possibly damaging Het
Ighv9-2 A C 12: 114,109,285 F23V probably benign Het
Igsf10 T C 3: 59,320,132 E2040G probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myh4 A G 11: 67,259,191 probably null Het
Nlrp2 T C 7: 5,328,119 D426G probably benign Het
Olfr403 T C 11: 74,196,033 F177L probably damaging Het
Otof T C 5: 30,376,720 D1415G probably benign Het
Ppig T C 2: 69,750,224 S701P unknown Het
Ptprf A G 4: 118,235,634 I528T probably damaging Het
Scara3 A G 14: 65,931,038 Y377H probably damaging Het
Slf1 A T 13: 77,106,010 *176R probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tarm1 T C 7: 3,497,568 Y61C probably damaging Het
Tlr1 A T 5: 64,925,802 N477K probably damaging Het
Tns2 C T 15: 102,111,229 T518M probably damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Vmn2r85 T C 10: 130,422,705 I494V possibly damaging Het
Wdr17 T A 8: 54,632,318 I1257F probably damaging Het
Zfp874a T C 13: 67,442,680 H295R probably damaging Het
Other mutations in Tle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tle4 APN 19 14468261 missense probably benign 0.00
IGL01449:Tle4 APN 19 14465340 missense probably benign 0.00
IGL01618:Tle4 APN 19 14544814 missense probably benign 0.07
IGL01636:Tle4 APN 19 14452533 missense probably damaging 0.97
IGL01750:Tle4 APN 19 14449789 missense probably damaging 1.00
IGL02376:Tle4 APN 19 14594404 missense probably damaging 1.00
R0006:Tle4 UTSW 19 14466714 splice site probably benign
R1068:Tle4 UTSW 19 14452179 missense probably damaging 1.00
R1174:Tle4 UTSW 19 14468262 missense probably benign
R1594:Tle4 UTSW 19 14453606 nonsense probably null
R1671:Tle4 UTSW 19 14453739 missense probably damaging 1.00
R1891:Tle4 UTSW 19 14544786 critical splice donor site probably null
R1951:Tle4 UTSW 19 14516357 critical splice donor site probably null
R2068:Tle4 UTSW 19 14449749 nonsense probably null
R3858:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3859:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3946:Tle4 UTSW 19 14597388 missense probably damaging 0.98
R4357:Tle4 UTSW 19 14468261 missense probably benign 0.00
R4395:Tle4 UTSW 19 14517938 missense probably benign 0.20
R4491:Tle4 UTSW 19 14454865 missense probably damaging 1.00
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R5516:Tle4 UTSW 19 14454889 missense probably damaging 0.99
R5611:Tle4 UTSW 19 14449795 missense probably damaging 1.00
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6113:Tle4 UTSW 19 14595588 critical splice donor site probably null
R6513:Tle4 UTSW 19 14451692 missense probably damaging 0.99
R6995:Tle4 UTSW 19 14564453 critical splice acceptor site probably null
R7175:Tle4 UTSW 19 14451707 missense probably damaging 1.00
R7310:Tle4 UTSW 19 14517791 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGTATGAGTGTTATGTTCCATACC -3'
(R):5'- TGATGCCCTCATTGGACCAG -3'

Sequencing Primer
(F):5'- GGAACTCCTAGTATTCTTGAACCAAG -3'
(R):5'- TCATTGGACCAGGGATCCC -3'
Posted On2016-08-04