Incidental Mutation 'R5337:Gpr155'
ID423548
Institutional Source Beutler Lab
Gene Symbol Gpr155
Ensembl Gene ENSMUSG00000041762
Gene NameG protein-coupled receptor 155
SynonymsPGR22, 1110017O10Rik, DEPDC3, F730029F15Rik
MMRRC Submission 042917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5337 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location73341506-73386572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73348248 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 704 (E704G)
Ref Sequence ENSEMBL: ENSMUSP00000107675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076463] [ENSMUST00000112043] [ENSMUST00000112044]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048504
SMART Domains Protein: ENSMUSP00000037772
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 1.9e-16 PFAM
Pfam:Mem_trans 187 360 4.9e-12 PFAM
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076463
AA Change: E732G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075788
Gene: ENSMUSG00000041762
AA Change: E732G

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112043
AA Change: E732G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107674
Gene: ENSMUSG00000041762
AA Change: E732G

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112044
AA Change: E704G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107675
Gene: ENSMUSG00000041762
AA Change: E704G

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
Pfam:Mem_trans 187 360 8.3e-11 PFAM
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 414 436 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
transmembrane domain 629 651 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
DEP 731 805 8.28e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131430
AA Change: E172G
SMART Domains Protein: ENSMUSP00000114294
Gene: ENSMUSG00000041762
AA Change: E172G

DomainStartEndE-ValueType
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184503
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C A 9: 50,765,749 C14F probably benign Het
2610507B11Rik T A 11: 78,265,208 I182N possibly damaging Het
Abhd15 T A 11: 77,518,839 probably null Het
Akap8l A G 17: 32,336,394 M237T possibly damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Api5 G T 2: 94,425,688 A218E possibly damaging Het
BC067074 T A 13: 113,318,765 H448Q probably damaging Het
Cftr A G 6: 18,319,059 D1336G probably damaging Het
Chd1l G A 3: 97,562,616 R865W probably damaging Het
Cmya5 T C 13: 93,083,273 K3223E probably benign Het
Cuzd1 A G 7: 131,316,074 Y266H probably damaging Het
Dnajc5b A T 3: 19,574,782 Y80F probably damaging Het
Dock6 A G 9: 21,829,548 S915P possibly damaging Het
Fam166b C T 4: 43,427,687 probably null Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fat4 A G 3: 39,010,378 T4828A probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja3 T G 14: 57,035,832 D361A probably benign Het
Greb1l A G 18: 10,509,143 E485G probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
H6pd A G 4: 149,981,784 V715A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnip1 T G 11: 33,642,389 probably benign Het
Kif21b T C 1: 136,171,143 S1390P probably damaging Het
Lrrc61 G A 6: 48,568,374 V44M probably damaging Het
Map3k4 G T 17: 12,271,610 N311K probably damaging Het
Mgat5 T C 1: 127,459,921 F538S possibly damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndst1 A T 18: 60,690,007 L829Q probably damaging Het
Neto1 A T 18: 86,398,309 H47L probably benign Het
Olfr1333 T C 4: 118,829,666 Y258C probably benign Het
Olfr485 A T 7: 108,159,273 V200D probably benign Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Olfr807 A T 10: 129,754,534 C305* probably null Het
Olfr9 A G 10: 128,990,679 T256A probably benign Het
Pds5b T C 5: 150,793,597 F1120L probably benign Het
Phkb A G 8: 85,878,245 Y93C probably damaging Het
Pilra C T 5: 137,835,770 probably benign Het
Pmvk T C 3: 89,468,571 V146A probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Psg23 A T 7: 18,612,072 W233R probably benign Het
Rgl2 A T 17: 33,934,984 I455F probably damaging Het
Rhpn1 A G 15: 75,708,205 Q39R probably benign Het
Rims4 T G 2: 163,865,843 M100L probably benign Het
Sacs T A 14: 61,193,514 probably benign Het
Slfn4 T C 11: 83,189,229 F189L probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tmem127 T C 2: 127,256,145 Y129H probably damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Trpc3 A T 3: 36,638,370 probably benign Het
Tsga10ip A T 19: 5,394,335 S23T probably benign Het
Uspl1 T C 5: 149,214,746 S720P probably damaging Het
Zc3h18 A G 8: 122,386,902 D211G probably damaging Het
Zcchc6 G A 13: 59,791,852 T695I probably damaging Het
Zswim4 G A 8: 84,235,079 P55L probably damaging Het
Other mutations in Gpr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gpr155 APN 2 73362613 missense probably damaging 1.00
IGL01432:Gpr155 APN 2 73351885 missense possibly damaging 0.51
IGL01528:Gpr155 APN 2 73362423 critical splice donor site probably null
IGL01718:Gpr155 APN 2 73382232 missense probably benign
IGL01733:Gpr155 APN 2 73353612 splice site probably null
IGL03342:Gpr155 APN 2 73349678 missense probably damaging 1.00
PIT1430001:Gpr155 UTSW 2 73370138 missense probably benign 0.08
PIT4810001:Gpr155 UTSW 2 73348263 missense probably benign 0.08
R0226:Gpr155 UTSW 2 73367592 missense probably benign 0.02
R0399:Gpr155 UTSW 2 73370002 missense possibly damaging 0.91
R0445:Gpr155 UTSW 2 73370144 splice site probably benign
R1570:Gpr155 UTSW 2 73370038 missense possibly damaging 0.87
R1598:Gpr155 UTSW 2 73370090 missense probably damaging 0.98
R1647:Gpr155 UTSW 2 73364164 unclassified probably null
R1648:Gpr155 UTSW 2 73364164 unclassified probably null
R1756:Gpr155 UTSW 2 73367577 missense probably benign 0.00
R1760:Gpr155 UTSW 2 73381935 missense probably damaging 1.00
R2033:Gpr155 UTSW 2 73348182 missense probably benign 0.18
R2044:Gpr155 UTSW 2 73373633 missense probably damaging 1.00
R2145:Gpr155 UTSW 2 73356658 missense probably benign 0.01
R2172:Gpr155 UTSW 2 73382127 missense probably benign 0.00
R2274:Gpr155 UTSW 2 73348135 critical splice donor site probably null
R3878:Gpr155 UTSW 2 73368392 nonsense probably null
R3924:Gpr155 UTSW 2 73370076 missense probably damaging 1.00
R4910:Gpr155 UTSW 2 73367538 nonsense probably null
R4950:Gpr155 UTSW 2 73382185 missense probably benign
R5830:Gpr155 UTSW 2 73370089 missense possibly damaging 0.93
R5887:Gpr155 UTSW 2 73343718 nonsense probably null
R5929:Gpr155 UTSW 2 73373667 nonsense probably null
R6293:Gpr155 UTSW 2 73373997 missense possibly damaging 0.47
R6553:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R6585:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R7003:Gpr155 UTSW 2 73343617 missense probably damaging 0.99
R7353:Gpr155 UTSW 2 73367491 nonsense probably null
R7506:Gpr155 UTSW 2 73368339 missense probably damaging 0.97
R7631:Gpr155 UTSW 2 73382947 intron probably benign
R7753:Gpr155 UTSW 2 73382206 missense probably benign 0.27
R7810:Gpr155 UTSW 2 73381952 missense probably damaging 0.99
R7813:Gpr155 UTSW 2 73381985 nonsense probably null
R7815:Gpr155 UTSW 2 73362560 missense probably benign
R7873:Gpr155 UTSW 2 73343590 missense possibly damaging 0.51
R7956:Gpr155 UTSW 2 73343590 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CAGAGAGATCAGAAGCTGCCTG -3'
(R):5'- GAGACAGTCTGAGACATCCTG -3'

Sequencing Primer
(F):5'- GGGCAAGGATCAACTATTAGCTC -3'
(R):5'- AGTCTGAGACATCCTGCCTAG -3'
Posted On2016-08-04