Incidental Mutation 'R5337:Olfr9'
ID423580
Institutional Source Beutler Lab
Gene Symbol Olfr9
Ensembl Gene ENSMUSG00000069430
Gene Nameolfactory receptor 9
SynonymsMOR269-3, GA_x6K02T2PULF-10675610-10676548
MMRRC Submission 042917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5337 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128989431-128992102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128990679 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 256 (T256A)
Ref Sequence ENSEMBL: ENSMUSP00000089622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091996]
Predicted Effect probably benign
Transcript: ENSMUST00000091996
AA Change: T256A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000089622
Gene: ENSMUSG00000069430
AA Change: T256A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.9e-10 PFAM
Pfam:7tm_1 41 290 7.3e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C A 9: 50,765,749 C14F probably benign Het
2610507B11Rik T A 11: 78,265,208 I182N possibly damaging Het
Abhd15 T A 11: 77,518,839 probably null Het
Akap8l A G 17: 32,336,394 M237T possibly damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Api5 G T 2: 94,425,688 A218E possibly damaging Het
BC067074 T A 13: 113,318,765 H448Q probably damaging Het
Cftr A G 6: 18,319,059 D1336G probably damaging Het
Chd1l G A 3: 97,562,616 R865W probably damaging Het
Cmya5 T C 13: 93,083,273 K3223E probably benign Het
Cuzd1 A G 7: 131,316,074 Y266H probably damaging Het
Dnajc5b A T 3: 19,574,782 Y80F probably damaging Het
Dock6 A G 9: 21,829,548 S915P possibly damaging Het
Fam166b C T 4: 43,427,687 probably null Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fat4 A G 3: 39,010,378 T4828A probably benign Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja3 T G 14: 57,035,832 D361A probably benign Het
Gpr155 T C 2: 73,348,248 E704G probably benign Het
Greb1l A G 18: 10,509,143 E485G probably damaging Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
H6pd A G 4: 149,981,784 V715A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnip1 T G 11: 33,642,389 probably benign Het
Kif21b T C 1: 136,171,143 S1390P probably damaging Het
Lrrc61 G A 6: 48,568,374 V44M probably damaging Het
Map3k4 G T 17: 12,271,610 N311K probably damaging Het
Mgat5 T C 1: 127,459,921 F538S possibly damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndst1 A T 18: 60,690,007 L829Q probably damaging Het
Neto1 A T 18: 86,398,309 H47L probably benign Het
Olfr1333 T C 4: 118,829,666 Y258C probably benign Het
Olfr485 A T 7: 108,159,273 V200D probably benign Het
Olfr550 T C 7: 102,579,274 S260P probably damaging Het
Olfr807 A T 10: 129,754,534 C305* probably null Het
Pds5b T C 5: 150,793,597 F1120L probably benign Het
Phkb A G 8: 85,878,245 Y93C probably damaging Het
Pilra C T 5: 137,835,770 probably benign Het
Pmvk T C 3: 89,468,571 V146A probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Psg23 A T 7: 18,612,072 W233R probably benign Het
Rgl2 A T 17: 33,934,984 I455F probably damaging Het
Rhpn1 A G 15: 75,708,205 Q39R probably benign Het
Rims4 T G 2: 163,865,843 M100L probably benign Het
Sacs T A 14: 61,193,514 probably benign Het
Slfn4 T C 11: 83,189,229 F189L probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tmem127 T C 2: 127,256,145 Y129H probably damaging Het
Trim50 C T 5: 135,367,476 T426M probably damaging Het
Trpc3 A T 3: 36,638,370 probably benign Het
Tsga10ip A T 19: 5,394,335 S23T probably benign Het
Uspl1 T C 5: 149,214,746 S720P probably damaging Het
Zc3h18 A G 8: 122,386,902 D211G probably damaging Het
Zcchc6 G A 13: 59,791,852 T695I probably damaging Het
Zswim4 G A 8: 84,235,079 P55L probably damaging Het
Other mutations in Olfr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr9 APN 10 128990701 missense probably benign 0.19
IGL02934:Olfr9 APN 10 128990089 missense probably damaging 1.00
R0180:Olfr9 UTSW 10 128990834 missense possibly damaging 0.87
R1716:Olfr9 UTSW 10 128990852 makesense probably null
R5066:Olfr9 UTSW 10 128990791 missense probably damaging 1.00
R5980:Olfr9 UTSW 10 128990440 missense probably damaging 0.98
R6815:Olfr9 UTSW 10 128990322 missense probably benign 0.17
R6924:Olfr9 UTSW 10 128990091 missense probably damaging 1.00
R8297:Olfr9 UTSW 10 128990839 missense possibly damaging 0.87
R8312:Olfr9 UTSW 10 128990478 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TACTGCAAGCACTTTCTGGG -3'
(R):5'- GCTCTGAGCTCCAAGATCTTG -3'

Sequencing Primer
(F):5'- CAAGCACTTTCTGGGGTGAAG -3'
(R):5'- CAAGATCTTGGGACTGTGGTCAAG -3'
Posted On2016-08-04