Incidental Mutation 'R5337:Rgl2'
ID 423597
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 042917-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R5337 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34153958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 455 (I455F)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000179418] [ENSMUST00000174426]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047503
AA Change: I455F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: I455F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect unknown
Transcript: ENSMUST00000173284
AA Change: I19F
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: I19F

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Meta Mutation Damage Score 0.7716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 T A 11: 77,409,665 (GRCm39) probably null Het
Akap8l A G 17: 32,555,368 (GRCm39) M237T possibly damaging Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Api5 G T 2: 94,256,033 (GRCm39) A218E possibly damaging Het
Bltp2 T A 11: 78,156,034 (GRCm39) I182N possibly damaging Het
Cfap68 C A 9: 50,677,049 (GRCm39) C14F probably benign Het
Cftr A G 6: 18,319,058 (GRCm39) D1336G probably damaging Het
Chd1l G A 3: 97,469,932 (GRCm39) R865W probably damaging Het
Cimip2b C T 4: 43,427,687 (GRCm39) probably null Het
Cmya5 T C 13: 93,219,781 (GRCm39) K3223E probably benign Het
Cspg4b T A 13: 113,455,299 (GRCm39) H448Q probably damaging Het
Cuzd1 A G 7: 130,917,803 (GRCm39) Y266H probably damaging Het
Dnajc5b A T 3: 19,628,946 (GRCm39) Y80F probably damaging Het
Dock6 A G 9: 21,740,844 (GRCm39) S915P possibly damaging Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fat4 A G 3: 39,064,527 (GRCm39) T4828A probably benign Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gja3 T G 14: 57,273,289 (GRCm39) D361A probably benign Het
Gpr155 T C 2: 73,178,592 (GRCm39) E704G probably benign Het
Greb1l A G 18: 10,509,143 (GRCm39) E485G probably damaging Het
Grik1 CGG CGGG 16: 87,720,082 (GRCm39) probably null Het
H6pd A G 4: 150,066,241 (GRCm39) V715A probably benign Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kcnip1 T G 11: 33,592,389 (GRCm39) probably benign Het
Kif21b T C 1: 136,098,881 (GRCm39) S1390P probably damaging Het
Lrrc61 G A 6: 48,545,308 (GRCm39) V44M probably damaging Het
Map3k4 G T 17: 12,490,497 (GRCm39) N311K probably damaging Het
Mgat5 T C 1: 127,387,658 (GRCm39) F538S possibly damaging Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Ndst1 A T 18: 60,823,079 (GRCm39) L829Q probably damaging Het
Neto1 A T 18: 86,416,434 (GRCm39) H47L probably benign Het
Or10ak11 T C 4: 118,686,863 (GRCm39) Y258C probably benign Het
Or10p22 A G 10: 128,826,548 (GRCm39) T256A probably benign Het
Or51r1 T C 7: 102,228,481 (GRCm39) S260P probably damaging Het
Or5p61 A T 7: 107,758,480 (GRCm39) V200D probably benign Het
Or6c214 A T 10: 129,590,403 (GRCm39) C305* probably null Het
Pds5b T C 5: 150,717,062 (GRCm39) F1120L probably benign Het
Phkb A G 8: 86,604,874 (GRCm39) Y93C probably damaging Het
Pilra C T 5: 137,834,032 (GRCm39) probably benign Het
Pmvk T C 3: 89,375,878 (GRCm39) V146A probably benign Het
Proz T A 8: 13,116,854 (GRCm39) D135E probably benign Het
Psg23 A T 7: 18,345,997 (GRCm39) W233R probably benign Het
Rhpn1 A G 15: 75,580,054 (GRCm39) Q39R probably benign Het
Rims4 T G 2: 163,707,763 (GRCm39) M100L probably benign Het
Sacs T A 14: 61,430,963 (GRCm39) probably benign Het
Slfn4 T C 11: 83,080,055 (GRCm39) F189L probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Tmem127 T C 2: 127,098,065 (GRCm39) Y129H probably damaging Het
Trim50 C T 5: 135,396,330 (GRCm39) T426M probably damaging Het
Trpc3 A T 3: 36,692,519 (GRCm39) probably benign Het
Tsga10ip A T 19: 5,444,363 (GRCm39) S23T probably benign Het
Tut7 G A 13: 59,939,666 (GRCm39) T695I probably damaging Het
Uspl1 T C 5: 149,151,556 (GRCm39) S720P probably damaging Het
Zc3h18 A G 8: 123,113,641 (GRCm39) D211G probably damaging Het
Zswim4 G A 8: 84,961,708 (GRCm39) P55L probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTGTCAAGTGGAGCTG -3'
(R):5'- ACATTCTTTCTGGAGGCGC -3'

Sequencing Primer
(F):5'- GCTACACAGTGAGTCCCAGTCTC -3'
(R):5'- CATTCTTTCTGGAGGCGCAACAG -3'
Posted On 2016-08-04