Mutagenetix > Incidental Mutations

Incidental Mutation 'R5337:Ndst1'

423599

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

042917-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5337 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60690007 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 829 (L829Q)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

Predicted Effect

probably damaging
Transcript: ENSMUST00000169273
AA Change: L829Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: L829Q

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.9234

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	C	A	9: 50,765,749	C14F	probably benign	Het
2610507B11Rik	T	A	11: 78,265,208	I182N	possibly damaging	Het
Abhd15	T	A	11: 77,518,839		probably null	Het
Akap8l	A	G	17: 32,336,394	M237T	possibly damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Api5	G	T	2: 94,425,688	A218E	possibly damaging	Het
BC067074	T	A	13: 113,318,765	H448Q	probably damaging	Het
Cftr	A	G	6: 18,319,059	D1336G	probably damaging	Het
Chd1l	G	A	3: 97,562,616	R865W	probably damaging	Het
Cmya5	T	C	13: 93,083,273	K3223E	probably benign	Het
Cuzd1	A	G	7: 131,316,074	Y266H	probably damaging	Het
Dnajc5b	A	T	3: 19,574,782	Y80F	probably damaging	Het
Dock6	A	G	9: 21,829,548	S915P	possibly damaging	Het
Fam166b	C	T	4: 43,427,687		probably null	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fat4	A	G	3: 39,010,378	T4828A	probably benign	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gja3	T	G	14: 57,035,832	D361A	probably benign	Het
Gpr155	T	C	2: 73,348,248	E704G	probably benign	Het
Greb1l	A	G	18: 10,509,143	E485G	probably damaging	Het
Grik1	CGG	CGGG	16: 87,923,194		probably null	Het
H6pd	A	G	4: 149,981,784	V715A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnip1	T	G	11: 33,642,389		probably benign	Het
Kif21b	T	C	1: 136,171,143	S1390P	probably damaging	Het
Lrrc61	G	A	6: 48,568,374	V44M	probably damaging	Het
Map3k4	G	T	17: 12,271,610	N311K	probably damaging	Het
Mgat5	T	C	1: 127,459,921	F538S	possibly damaging	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Neto1	A	T	18: 86,398,309	H47L	probably benign	Het
Olfr1333	T	C	4: 118,829,666	Y258C	probably benign	Het
Olfr485	A	T	7: 108,159,273	V200D	probably benign	Het
Olfr550	T	C	7: 102,579,274	S260P	probably damaging	Het
Olfr807	A	T	10: 129,754,534	C305*	probably null	Het
Olfr9	A	G	10: 128,990,679	T256A	probably benign	Het
Pds5b	T	C	5: 150,793,597	F1120L	probably benign	Het
Phkb	A	G	8: 85,878,245	Y93C	probably damaging	Het
Pilra	C	T	5: 137,835,770		probably benign	Het
Pmvk	T	C	3: 89,468,571	V146A	probably benign	Het
Proz	T	A	8: 13,066,854	D135E	probably benign	Het
Psg23	A	T	7: 18,612,072	W233R	probably benign	Het
Rgl2	A	T	17: 33,934,984	I455F	probably damaging	Het
Rhpn1	A	G	15: 75,708,205	Q39R	probably benign	Het
Rims4	T	G	2: 163,865,843	M100L	probably benign	Het
Sacs	T	A	14: 61,193,514		probably benign	Het
Slfn4	T	C	11: 83,189,229	F189L	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tmem127	T	C	2: 127,256,145	Y129H	probably damaging	Het
Trim50	C	T	5: 135,367,476	T426M	probably damaging	Het
Trpc3	A	T	3: 36,638,370		probably benign	Het
Tsga10ip	A	T	19: 5,394,335	S23T	probably benign	Het
Uspl1	T	C	5: 149,214,746	S720P	probably damaging	Het
Zc3h18	A	G	8: 122,386,902	D211G	probably damaging	Het
Zcchc6	G	A	13: 59,791,852	T695I	probably damaging	Het
Zswim4	G	A	8: 84,235,079	P55L	probably damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTAAAGAAACACTGACTATCC -3'
(R):5'- ACAGATGGCAAGTGTCAGGC -3'

Sequencing Primer
(F):5'- AACCCTATGTCCTTCTCTAGAGGATG -3'
(R):5'- TGTCAGGCAGCATAGTGAC -3'

Posted On

2016-08-04