Incidental Mutation 'R5338:Mastl'
ID423606
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Namemicrotubule associated serine/threonine kinase-like
Synonyms2700091H24Rik, THC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5338 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location23115606-23156024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23133491 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 407 (S407T)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
Predicted Effect probably benign
Transcript: ENSMUST00000028119
AA Change: S407T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: S407T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,620,544 N252K probably damaging Het
Abhd16a A G 17: 35,094,302 E132G probably damaging Het
Adgrv1 G A 13: 81,529,046 R1889W possibly damaging Het
Aftph A T 11: 20,727,203 D135E probably benign Het
Arf1 A C 11: 59,213,215 F63V probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
B3gnt7 T A 1: 86,305,644 F87Y probably damaging Het
Bcat1 A G 6: 145,007,627 Y345H possibly damaging Het
Birc3 G T 9: 7,857,359 T371K probably benign Het
Ccdc175 A T 12: 72,184,971 S5T probably damaging Het
Ccdc186 A T 19: 56,813,257 S143T possibly damaging Het
Cct6b A T 11: 82,762,189 M28K possibly damaging Het
Cers4 C A 8: 4,515,680 A42D probably damaging Het
Crmp1 G T 5: 37,279,674 V236L probably benign Het
Ctdspl2 T A 2: 121,981,312 N212K probably benign Het
Dclk3 T C 9: 111,469,059 V557A possibly damaging Het
Dnmt1 A T 9: 20,952,719 H23Q probably benign Het
Dpp8 G T 9: 65,063,924 E609* probably null Het
Dtx3 C A 10: 127,193,050 M106I probably benign Het
Ero1lb A C 13: 12,574,851 D45A probably damaging Het
Fcho2 T A 13: 98,730,891 D688V probably damaging Het
Fhod3 A T 18: 25,028,081 S557C probably damaging Het
Flnc T C 6: 29,444,064 S626P possibly damaging Het
Foxi3 G T 6: 70,960,618 G278V probably damaging Het
Gbp10 A G 5: 105,224,300 L198P probably damaging Het
Gcn1l1 A G 5: 115,583,403 T458A probably benign Het
Gigyf1 C T 5: 137,523,160 probably benign Het
Gtpbp2 A C 17: 46,167,834 T526P probably damaging Het
Gys2 A G 6: 142,454,513 L324S probably damaging Het
Hpn C A 7: 31,103,356 V119L probably benign Het
Ino80d C A 1: 63,058,939 V599L probably benign Het
Kcnh3 G T 15: 99,242,394 G1054* probably null Het
Maml1 A T 11: 50,266,951 D132E probably benign Het
Mettl1 T C 10: 127,043,085 W3R probably damaging Het
Mprip A G 11: 59,760,573 Y1701C probably damaging Het
Mylk3 T C 8: 85,342,721 N484D probably damaging Het
Nod2 G A 8: 88,672,785 probably null Het
Nrde2 A T 12: 100,130,778 F921Y probably damaging Het
Nup88 G T 11: 70,944,908 T575N probably damaging Het
Nxpe3 T C 16: 55,866,343 T101A possibly damaging Het
Olfr1214 C T 2: 88,987,465 V246I possibly damaging Het
Olfr458 A G 6: 42,460,974 M15T probably benign Het
Olfr672 A G 7: 104,996,307 L199S possibly damaging Het
Olfr951 A T 9: 39,394,075 I92F probably damaging Het
Olfr98 T A 17: 37,263,641 T8S probably benign Het
Pcnx3 A T 19: 5,672,596 L1356Q probably damaging Het
Pkd1 A T 17: 24,594,536 M4017L probably benign Het
Polg2 A G 11: 106,779,238 C69R possibly damaging Het
Prr5l T G 2: 101,717,107 S358R probably benign Het
Ptprg A G 14: 12,154,111 T611A probably benign Het
Ryk G T 9: 102,897,317 E417* probably null Het
Sbp T C 17: 23,942,422 probably benign Het
Sema4a T C 3: 88,451,497 T155A probably benign Het
Shank3 A G 15: 89,531,711 probably null Het
Slc35d2 A T 13: 64,097,682 M294K possibly damaging Het
Slc41a3 A T 6: 90,612,171 N88I possibly damaging Het
Slit3 A G 11: 35,622,148 T534A probably benign Het
Ssx2ip A G 3: 146,436,541 probably null Het
Stard13 T C 5: 151,059,598 K648R probably damaging Het
Tanc1 A T 2: 59,795,834 T512S probably damaging Het
Tbcc T C 17: 46,891,156 V156A probably benign Het
Terf1 T G 1: 15,831,563 I273R possibly damaging Het
Tesc A G 5: 118,059,458 Y179C probably damaging Het
Ttc3 T G 16: 94,384,041 V40G probably damaging Het
Tysnd1 T A 10: 61,696,249 F227I probably damaging Het
Vps53 T C 11: 76,081,208 E271G probably damaging Het
Wdfy4 C T 14: 33,090,866 R1650H probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R0712:Mastl UTSW 2 23150993 missense probably damaging 1.00
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3799:Mastl UTSW 2 23140492 splice site probably benign
R3840:Mastl UTSW 2 23140551 missense probably damaging 1.00
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R4845:Mastl UTSW 2 23139998 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6158:Mastl UTSW 2 23132772 missense possibly damaging 0.92
R6450:Mastl UTSW 2 23120929 missense probably damaging 1.00
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
R7233:Mastl UTSW 2 23133658 missense probably benign
R7249:Mastl UTSW 2 23146139 missense probably damaging 1.00
R7347:Mastl UTSW 2 23133389 missense probably damaging 0.99
R7371:Mastl UTSW 2 23140573 missense probably damaging 1.00
R7726:Mastl UTSW 2 23140795 splice site probably null
R8057:Mastl UTSW 2 23133554 missense possibly damaging 0.75
R8288:Mastl UTSW 2 23133359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATTTGCACGGCAGCC -3'
(R):5'- TGGAATGCAGTTGAAATGCTG -3'

Sequencing Primer
(F):5'- GCAGCCTTGCCTTTCCTTATTGG -3'
(R):5'- GCTGTATGCAAAATCTACAAGTGCC -3'
Posted On2016-08-04