Incidental Mutation 'R5338:Mastl'
ID 423606
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms THC2, 2700091H24Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5338 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 23006549-23046036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23023503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 407 (S407T)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
AlphaFold Q8C0P0
Predicted Effect probably benign
Transcript: ENSMUST00000028119
AA Change: S407T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: S407T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,502,597 (GRCm39) N252K probably damaging Het
Abhd16a A G 17: 35,313,278 (GRCm39) E132G probably damaging Het
Adgrv1 G A 13: 81,677,165 (GRCm39) R1889W possibly damaging Het
Aftph A T 11: 20,677,203 (GRCm39) D135E probably benign Het
Arf1 A C 11: 59,104,041 (GRCm39) F63V probably damaging Het
Atg14 G A 14: 47,805,656 (GRCm39) R70C probably damaging Het
B3gnt7 T A 1: 86,233,366 (GRCm39) F87Y probably damaging Het
Bcat1 A G 6: 144,953,353 (GRCm39) Y345H possibly damaging Het
Birc2 G T 9: 7,857,360 (GRCm39) T371K probably benign Het
Ccdc175 A T 12: 72,231,745 (GRCm39) S5T probably damaging Het
Ccdc186 A T 19: 56,801,689 (GRCm39) S143T possibly damaging Het
Cct6b A T 11: 82,653,015 (GRCm39) M28K possibly damaging Het
Cers4 C A 8: 4,565,680 (GRCm39) A42D probably damaging Het
Crmp1 G T 5: 37,437,018 (GRCm39) V236L probably benign Het
Ctdspl2 T A 2: 121,811,793 (GRCm39) N212K probably benign Het
Dclk3 T C 9: 111,298,127 (GRCm39) V557A possibly damaging Het
Dnmt1 A T 9: 20,864,015 (GRCm39) H23Q probably benign Het
Dpp8 G T 9: 64,971,206 (GRCm39) E609* probably null Het
Dtx3 C A 10: 127,028,919 (GRCm39) M106I probably benign Het
Ero1b A C 13: 12,589,732 (GRCm39) D45A probably damaging Het
Fcho2 T A 13: 98,867,399 (GRCm39) D688V probably damaging Het
Fhod3 A T 18: 25,161,138 (GRCm39) S557C probably damaging Het
Flnc T C 6: 29,444,063 (GRCm39) S626P possibly damaging Het
Foxi3 G T 6: 70,937,602 (GRCm39) G278V probably damaging Het
Gbp10 A G 5: 105,372,166 (GRCm39) L198P probably damaging Het
Gcn1 A G 5: 115,721,462 (GRCm39) T458A probably benign Het
Gigyf1 C T 5: 137,521,422 (GRCm39) probably benign Het
Gtpbp2 A C 17: 46,478,760 (GRCm39) T526P probably damaging Het
Gys2 A G 6: 142,400,239 (GRCm39) L324S probably damaging Het
Hpn C A 7: 30,802,781 (GRCm39) V119L probably benign Het
Ino80d C A 1: 63,098,098 (GRCm39) V599L probably benign Het
Kcnh3 G T 15: 99,140,275 (GRCm39) G1054* probably null Het
Maml1 A T 11: 50,157,778 (GRCm39) D132E probably benign Het
Mettl1 T C 10: 126,878,954 (GRCm39) W3R probably damaging Het
Mprip A G 11: 59,651,399 (GRCm39) Y1701C probably damaging Het
Mylk3 T C 8: 86,069,350 (GRCm39) N484D probably damaging Het
Nod2 G A 8: 89,399,413 (GRCm39) probably null Het
Nrde2 A T 12: 100,097,037 (GRCm39) F921Y probably damaging Het
Nup88 G T 11: 70,835,734 (GRCm39) T575N probably damaging Het
Nxpe3 T C 16: 55,686,706 (GRCm39) T101A possibly damaging Het
Or1o3 T A 17: 37,574,532 (GRCm39) T8S probably benign Het
Or2r11 A G 6: 42,437,908 (GRCm39) M15T probably benign Het
Or4c109 C T 2: 88,817,809 (GRCm39) V246I possibly damaging Het
Or52e15 A G 7: 104,645,514 (GRCm39) L199S possibly damaging Het
Or8g32 A T 9: 39,305,371 (GRCm39) I92F probably damaging Het
Pcnx3 A T 19: 5,722,624 (GRCm39) L1356Q probably damaging Het
Pkd1 A T 17: 24,813,510 (GRCm39) M4017L probably benign Het
Polg2 A G 11: 106,670,064 (GRCm39) C69R possibly damaging Het
Prr5l T G 2: 101,547,452 (GRCm39) S358R probably benign Het
Ptprg A G 14: 12,154,111 (GRCm38) T611A probably benign Het
Ryk G T 9: 102,774,516 (GRCm39) E417* probably null Het
Sbp T C 17: 24,161,396 (GRCm39) probably benign Het
Sema4a T C 3: 88,358,804 (GRCm39) T155A probably benign Het
Shank3 A G 15: 89,415,914 (GRCm39) probably null Het
Slc35d2 A T 13: 64,245,496 (GRCm39) M294K possibly damaging Het
Slc41a3 A T 6: 90,589,153 (GRCm39) N88I possibly damaging Het
Slit3 A G 11: 35,512,975 (GRCm39) T534A probably benign Het
Ssx2ip A G 3: 146,142,296 (GRCm39) probably null Het
Stard13 T C 5: 150,983,063 (GRCm39) K648R probably damaging Het
Tanc1 A T 2: 59,626,178 (GRCm39) T512S probably damaging Het
Tbcc T C 17: 47,202,082 (GRCm39) V156A probably benign Het
Terf1 T G 1: 15,901,787 (GRCm39) I273R possibly damaging Het
Tesc A G 5: 118,197,523 (GRCm39) Y179C probably damaging Het
Ttc3 T G 16: 94,184,900 (GRCm39) V40G probably damaging Het
Tysnd1 T A 10: 61,532,028 (GRCm39) F227I probably damaging Het
Vps53 T C 11: 75,972,034 (GRCm39) E271G probably damaging Het
Wdfy4 C T 14: 32,812,823 (GRCm39) R1650H probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23,036,160 (GRCm39) missense probably damaging 1.00
IGL02103:Mastl APN 2 23,030,010 (GRCm39) missense probably benign 0.01
IGL02622:Mastl APN 2 23,022,857 (GRCm39) missense probably benign 0.12
IGL02826:Mastl APN 2 23,035,421 (GRCm39) missense probably damaging 1.00
IGL02896:Mastl APN 2 23,021,779 (GRCm39) missense probably damaging 1.00
IGL03024:Mastl APN 2 23,029,931 (GRCm39) missense probably damaging 1.00
IGL03038:Mastl APN 2 23,030,627 (GRCm39) splice site probably benign
R0600:Mastl UTSW 2 23,023,358 (GRCm39) missense probably benign 0.06
R0712:Mastl UTSW 2 23,041,005 (GRCm39) missense probably damaging 1.00
R1168:Mastl UTSW 2 23,023,144 (GRCm39) missense probably benign 0.06
R1750:Mastl UTSW 2 23,036,093 (GRCm39) nonsense probably null
R1911:Mastl UTSW 2 23,022,692 (GRCm39) nonsense probably null
R2051:Mastl UTSW 2 23,022,836 (GRCm39) missense possibly damaging 0.49
R2859:Mastl UTSW 2 23,029,979 (GRCm39) missense probably damaging 0.99
R3799:Mastl UTSW 2 23,030,504 (GRCm39) splice site probably benign
R3840:Mastl UTSW 2 23,030,563 (GRCm39) missense probably damaging 1.00
R4807:Mastl UTSW 2 23,022,855 (GRCm39) missense probably benign
R4818:Mastl UTSW 2 23,027,038 (GRCm39) missense probably benign 0.00
R4845:Mastl UTSW 2 23,030,010 (GRCm39) missense probably benign 0.01
R5364:Mastl UTSW 2 23,023,665 (GRCm39) missense probably benign 0.16
R6077:Mastl UTSW 2 23,045,806 (GRCm39) missense probably damaging 0.99
R6158:Mastl UTSW 2 23,022,784 (GRCm39) missense possibly damaging 0.92
R6450:Mastl UTSW 2 23,010,941 (GRCm39) missense probably damaging 1.00
R6602:Mastl UTSW 2 23,022,689 (GRCm39) missense probably benign 0.04
R6788:Mastl UTSW 2 23,023,710 (GRCm39) missense probably benign 0.22
R6908:Mastl UTSW 2 23,045,988 (GRCm39) start gained probably benign
R7058:Mastl UTSW 2 23,023,425 (GRCm39) nonsense probably null
R7233:Mastl UTSW 2 23,023,670 (GRCm39) missense probably benign
R7249:Mastl UTSW 2 23,036,151 (GRCm39) missense probably damaging 1.00
R7347:Mastl UTSW 2 23,023,401 (GRCm39) missense probably damaging 0.99
R7371:Mastl UTSW 2 23,030,585 (GRCm39) missense probably damaging 1.00
R7726:Mastl UTSW 2 23,030,807 (GRCm39) splice site probably null
R8057:Mastl UTSW 2 23,023,566 (GRCm39) missense possibly damaging 0.75
R8288:Mastl UTSW 2 23,023,371 (GRCm39) missense probably damaging 1.00
R9101:Mastl UTSW 2 23,008,449 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TTTGATTTGCACGGCAGCC -3'
(R):5'- TGGAATGCAGTTGAAATGCTG -3'

Sequencing Primer
(F):5'- GCAGCCTTGCCTTTCCTTATTGG -3'
(R):5'- GCTGTATGCAAAATCTACAAGTGCC -3'
Posted On 2016-08-04