Incidental Mutation 'R5338:Olfr1214'
ID423608
Institutional Source Beutler Lab
Gene Symbol Olfr1214
Ensembl Gene ENSMUSG00000075110
Gene Nameolfactory receptor 1214
SynonymsGA_x6K02T2Q125-50468705-50467770, MOR233-8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5338 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88986479-88992653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88987465 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 246 (V246I)
Ref Sequence ENSEMBL: ENSMUSP00000150322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099804] [ENSMUST00000216026] [ENSMUST00000217469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099804
AA Change: V246I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097392
Gene: ENSMUSG00000075110
AA Change: V246I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-45 PFAM
Pfam:7tm_1 39 286 4.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216026
AA Change: V246I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217469
AA Change: V246I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,620,544 N252K probably damaging Het
Abhd16a A G 17: 35,094,302 E132G probably damaging Het
Adgrv1 G A 13: 81,529,046 R1889W possibly damaging Het
Aftph A T 11: 20,727,203 D135E probably benign Het
Arf1 A C 11: 59,213,215 F63V probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
B3gnt7 T A 1: 86,305,644 F87Y probably damaging Het
Bcat1 A G 6: 145,007,627 Y345H possibly damaging Het
Birc3 G T 9: 7,857,359 T371K probably benign Het
Ccdc175 A T 12: 72,184,971 S5T probably damaging Het
Ccdc186 A T 19: 56,813,257 S143T possibly damaging Het
Cct6b A T 11: 82,762,189 M28K possibly damaging Het
Cers4 C A 8: 4,515,680 A42D probably damaging Het
Crmp1 G T 5: 37,279,674 V236L probably benign Het
Ctdspl2 T A 2: 121,981,312 N212K probably benign Het
Dclk3 T C 9: 111,469,059 V557A possibly damaging Het
Dnmt1 A T 9: 20,952,719 H23Q probably benign Het
Dpp8 G T 9: 65,063,924 E609* probably null Het
Dtx3 C A 10: 127,193,050 M106I probably benign Het
Ero1lb A C 13: 12,574,851 D45A probably damaging Het
Fcho2 T A 13: 98,730,891 D688V probably damaging Het
Fhod3 A T 18: 25,028,081 S557C probably damaging Het
Flnc T C 6: 29,444,064 S626P possibly damaging Het
Foxi3 G T 6: 70,960,618 G278V probably damaging Het
Gbp10 A G 5: 105,224,300 L198P probably damaging Het
Gcn1l1 A G 5: 115,583,403 T458A probably benign Het
Gigyf1 C T 5: 137,523,160 probably benign Het
Gtpbp2 A C 17: 46,167,834 T526P probably damaging Het
Gys2 A G 6: 142,454,513 L324S probably damaging Het
Hpn C A 7: 31,103,356 V119L probably benign Het
Ino80d C A 1: 63,058,939 V599L probably benign Het
Kcnh3 G T 15: 99,242,394 G1054* probably null Het
Maml1 A T 11: 50,266,951 D132E probably benign Het
Mastl A T 2: 23,133,491 S407T probably benign Het
Mettl1 T C 10: 127,043,085 W3R probably damaging Het
Mprip A G 11: 59,760,573 Y1701C probably damaging Het
Mylk3 T C 8: 85,342,721 N484D probably damaging Het
Nod2 G A 8: 88,672,785 probably null Het
Nrde2 A T 12: 100,130,778 F921Y probably damaging Het
Nup88 G T 11: 70,944,908 T575N probably damaging Het
Nxpe3 T C 16: 55,866,343 T101A possibly damaging Het
Olfr458 A G 6: 42,460,974 M15T probably benign Het
Olfr672 A G 7: 104,996,307 L199S possibly damaging Het
Olfr951 A T 9: 39,394,075 I92F probably damaging Het
Olfr98 T A 17: 37,263,641 T8S probably benign Het
Pcnx3 A T 19: 5,672,596 L1356Q probably damaging Het
Pkd1 A T 17: 24,594,536 M4017L probably benign Het
Polg2 A G 11: 106,779,238 C69R possibly damaging Het
Prr5l T G 2: 101,717,107 S358R probably benign Het
Ptprg A G 14: 12,154,111 T611A probably benign Het
Ryk G T 9: 102,897,317 E417* probably null Het
Sbp T C 17: 23,942,422 probably benign Het
Sema4a T C 3: 88,451,497 T155A probably benign Het
Shank3 A G 15: 89,531,711 probably null Het
Slc35d2 A T 13: 64,097,682 M294K possibly damaging Het
Slc41a3 A T 6: 90,612,171 N88I possibly damaging Het
Slit3 A G 11: 35,622,148 T534A probably benign Het
Ssx2ip A G 3: 146,436,541 probably null Het
Stard13 T C 5: 151,059,598 K648R probably damaging Het
Tanc1 A T 2: 59,795,834 T512S probably damaging Het
Tbcc T C 17: 46,891,156 V156A probably benign Het
Terf1 T G 1: 15,831,563 I273R possibly damaging Het
Tesc A G 5: 118,059,458 Y179C probably damaging Het
Ttc3 T G 16: 94,384,041 V40G probably damaging Het
Tysnd1 T A 10: 61,696,249 F227I probably damaging Het
Vps53 T C 11: 76,081,208 E271G probably damaging Het
Wdfy4 C T 14: 33,090,866 R1650H probably damaging Het
Other mutations in Olfr1214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Olfr1214 APN 2 88988080 missense probably benign 0.00
IGL03409:Olfr1214 APN 2 88987587 missense possibly damaging 0.93
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0503:Olfr1214 UTSW 2 88987978 missense probably benign 0.01
R0688:Olfr1214 UTSW 2 88987595 missense probably damaging 1.00
R1120:Olfr1214 UTSW 2 88988079 missense possibly damaging 0.51
R1752:Olfr1214 UTSW 2 88987315 missense possibly damaging 0.60
R2018:Olfr1214 UTSW 2 88988145 missense probably benign 0.06
R2281:Olfr1214 UTSW 2 88987470 missense probably benign 0.03
R2509:Olfr1214 UTSW 2 88987431 missense probably damaging 1.00
R2862:Olfr1214 UTSW 2 88987320 missense probably benign
R3942:Olfr1214 UTSW 2 88988111 missense probably benign 0.15
R4894:Olfr1214 UTSW 2 88987439 missense possibly damaging 0.83
R4899:Olfr1214 UTSW 2 88988110 missense probably null 0.13
R5089:Olfr1214 UTSW 2 88988172 missense probably damaging 1.00
R5253:Olfr1214 UTSW 2 88988100 missense possibly damaging 0.67
R6476:Olfr1214 UTSW 2 88987377 missense probably benign 0.06
Z1177:Olfr1214 UTSW 2 88987881 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAGGAACCATTATAAGTCTCTTCCTC -3'
(R):5'- TTCTGTGGACCCAATGTTATTGATC -3'

Sequencing Primer
(F):5'- AAGTCTCTTCCTCATTTTCCTGATGG -3'
(R):5'- GAAGCTTGCCTGCACTGATATAC -3'
Posted On2016-08-04