Incidental Mutation 'R5338:Ttc3'
ID423662
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R5338 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94384041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 40 (V40G)
Ref Sequence ENSEMBL: ENSMUSP00000156151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000119131] [ENSMUST00000122895] [ENSMUST00000139513] [ENSMUST00000141856] [ENSMUST00000143145] [ENSMUST00000145432] [ENSMUST00000145883] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000151770] [ENSMUST00000153062] [ENSMUST00000154243] [ENSMUST00000155692] [ENSMUST00000232660] [ENSMUST00000231915] [ENSMUST00000232395] [ENSMUST00000150346] [ENSMUST00000231569] [ENSMUST00000152117] [ENSMUST00000153988] [ENSMUST00000150097] [ENSMUST00000149885]
Predicted Effect probably damaging
Transcript: ENSMUST00000117648
AA Change: V40G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: V40G

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119131
AA Change: V40G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113311
Gene: ENSMUSG00000040785
AA Change: V40G

DomainStartEndE-ValueType
Pfam:TPR_11 229 285 1.1e-12 PFAM
Pfam:TPR_1 232 264 2.1e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122895
AA Change: V40G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785
AA Change: V40G

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127667
SMART Domains Protein: ENSMUSP00000122425
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 22 89 4.7e-16 PFAM
Pfam:TPR_2 24 57 5.7e-4 PFAM
Pfam:TPR_1 25 57 3.5e-5 PFAM
Pfam:TPR_9 35 103 3.2e-6 PFAM
Pfam:TPR_1 58 89 2.1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130960
Predicted Effect probably benign
Transcript: ENSMUST00000139513
SMART Domains Protein: ENSMUSP00000117881
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141856
SMART Domains Protein: ENSMUSP00000117369
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_1 90 121 1e-6 PFAM
Pfam:TPR_2 90 121 7.9e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143145
AA Change: V40G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000145432
AA Change: V40G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000145883
SMART Domains Protein: ENSMUSP00000123442
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147352
AA Change: V40G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785
AA Change: V40G

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149753
Predicted Effect probably damaging
Transcript: ENSMUST00000151770
AA Change: V40G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785
AA Change: V40G

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153062
AA Change: V40G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000154243
AA Change: V59G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000155692
AA Change: V59G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785
AA Change: V59G

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151192
Predicted Effect probably damaging
Transcript: ENSMUST00000232660
AA Change: V40G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000231915
AA Change: V40G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000232395
AA Change: V40G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000150346
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231569
Predicted Effect probably benign
Transcript: ENSMUST00000152117
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150097
SMART Domains Protein: ENSMUSP00000119035
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149885
SMART Domains Protein: ENSMUSP00000122006
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_2 1 31 3.5e-4 PFAM
Pfam:TPR_11 1 58 7.8e-16 PFAM
Pfam:TPR_1 2 31 1.8e-5 PFAM
Pfam:TPR_9 9 58 2.5e-6 PFAM
Pfam:TPR_17 20 53 4.2e-7 PFAM
Pfam:TPR_1 32 58 2.5e-4 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T A 9: 99,620,544 N252K probably damaging Het
Abhd16a A G 17: 35,094,302 E132G probably damaging Het
Adgrv1 G A 13: 81,529,046 R1889W possibly damaging Het
Aftph A T 11: 20,727,203 D135E probably benign Het
Arf1 A C 11: 59,213,215 F63V probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
B3gnt7 T A 1: 86,305,644 F87Y probably damaging Het
Bcat1 A G 6: 145,007,627 Y345H possibly damaging Het
Birc3 G T 9: 7,857,359 T371K probably benign Het
Ccdc175 A T 12: 72,184,971 S5T probably damaging Het
Ccdc186 A T 19: 56,813,257 S143T possibly damaging Het
Cct6b A T 11: 82,762,189 M28K possibly damaging Het
Cers4 C A 8: 4,515,680 A42D probably damaging Het
Crmp1 G T 5: 37,279,674 V236L probably benign Het
Ctdspl2 T A 2: 121,981,312 N212K probably benign Het
Dclk3 T C 9: 111,469,059 V557A possibly damaging Het
Dnmt1 A T 9: 20,952,719 H23Q probably benign Het
Dpp8 G T 9: 65,063,924 E609* probably null Het
Dtx3 C A 10: 127,193,050 M106I probably benign Het
Ero1lb A C 13: 12,574,851 D45A probably damaging Het
Fcho2 T A 13: 98,730,891 D688V probably damaging Het
Fhod3 A T 18: 25,028,081 S557C probably damaging Het
Flnc T C 6: 29,444,064 S626P possibly damaging Het
Foxi3 G T 6: 70,960,618 G278V probably damaging Het
Gbp10 A G 5: 105,224,300 L198P probably damaging Het
Gcn1l1 A G 5: 115,583,403 T458A probably benign Het
Gigyf1 C T 5: 137,523,160 probably benign Het
Gtpbp2 A C 17: 46,167,834 T526P probably damaging Het
Gys2 A G 6: 142,454,513 L324S probably damaging Het
Hpn C A 7: 31,103,356 V119L probably benign Het
Ino80d C A 1: 63,058,939 V599L probably benign Het
Kcnh3 G T 15: 99,242,394 G1054* probably null Het
Maml1 A T 11: 50,266,951 D132E probably benign Het
Mastl A T 2: 23,133,491 S407T probably benign Het
Mettl1 T C 10: 127,043,085 W3R probably damaging Het
Mprip A G 11: 59,760,573 Y1701C probably damaging Het
Mylk3 T C 8: 85,342,721 N484D probably damaging Het
Nod2 G A 8: 88,672,785 probably null Het
Nrde2 A T 12: 100,130,778 F921Y probably damaging Het
Nup88 G T 11: 70,944,908 T575N probably damaging Het
Nxpe3 T C 16: 55,866,343 T101A possibly damaging Het
Olfr1214 C T 2: 88,987,465 V246I possibly damaging Het
Olfr458 A G 6: 42,460,974 M15T probably benign Het
Olfr672 A G 7: 104,996,307 L199S possibly damaging Het
Olfr951 A T 9: 39,394,075 I92F probably damaging Het
Olfr98 T A 17: 37,263,641 T8S probably benign Het
Pcnx3 A T 19: 5,672,596 L1356Q probably damaging Het
Pkd1 A T 17: 24,594,536 M4017L probably benign Het
Polg2 A G 11: 106,779,238 C69R possibly damaging Het
Prr5l T G 2: 101,717,107 S358R probably benign Het
Ptprg A G 14: 12,154,111 T611A probably benign Het
Ryk G T 9: 102,897,317 E417* probably null Het
Sbp T C 17: 23,942,422 probably benign Het
Sema4a T C 3: 88,451,497 T155A probably benign Het
Shank3 A G 15: 89,531,711 probably null Het
Slc35d2 A T 13: 64,097,682 M294K possibly damaging Het
Slc41a3 A T 6: 90,612,171 N88I possibly damaging Het
Slit3 A G 11: 35,622,148 T534A probably benign Het
Ssx2ip A G 3: 146,436,541 probably null Het
Stard13 T C 5: 151,059,598 K648R probably damaging Het
Tanc1 A T 2: 59,795,834 T512S probably damaging Het
Tbcc T C 17: 46,891,156 V156A probably benign Het
Terf1 T G 1: 15,831,563 I273R possibly damaging Het
Tesc A G 5: 118,059,458 Y179C probably damaging Het
Tysnd1 T A 10: 61,696,249 F227I probably damaging Het
Vps53 T C 11: 76,081,208 E271G probably damaging Het
Wdfy4 C T 14: 33,090,866 R1650H probably damaging Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0480:Ttc3 UTSW 16 94432004 nonsense probably null
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2339:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2842:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4533:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 splice site probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
R7331:Ttc3 UTSW 16 94394359 missense probably benign 0.27
R7497:Ttc3 UTSW 16 94418682 missense possibly damaging 0.93
R7610:Ttc3 UTSW 16 94427838 missense probably benign 0.11
R7738:Ttc3 UTSW 16 94387382 missense probably benign 0.00
R7970:Ttc3 UTSW 16 94457364 missense probably damaging 1.00
R8052:Ttc3 UTSW 16 94467989 missense probably benign 0.09
R8087:Ttc3 UTSW 16 94442953 missense probably benign 0.00
R8309:Ttc3 UTSW 16 94466979 missense probably damaging 1.00
R8320:Ttc3 UTSW 16 94418676 missense probably damaging 1.00
R8322:Ttc3 UTSW 16 94454492 missense probably damaging 1.00
R8518:Ttc3 UTSW 16 94457379 missense probably benign 0.21
R8670:Ttc3 UTSW 16 94390208 missense probably damaging 0.99
R8826:Ttc3 UTSW 16 94431970 missense possibly damaging 0.85
R8868:Ttc3 UTSW 16 94451143 missense probably benign 0.00
R8873:Ttc3 UTSW 16 94442983 missense probably damaging 0.97
R8940:Ttc3 UTSW 16 94429499 missense possibly damaging 0.94
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGATGTCACTGCTGACTG -3'
(R):5'- GGAACTCATCTCGGGCTTTC -3'

Sequencing Primer
(F):5'- ACTGCTGACTGGAATGTCAC -3'
(R):5'- CTCAGGAGCCTGGTTGATCTC -3'
Posted On2016-08-04